Escherichia coli
speciesAt a glance
Occurrence records25 562
Data sources5
Biological traits0
DNA specimens446
eDNA detections449
Sources5 archives
Databases and archives Escherichia coli's data was compiled from.
On this page4 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
Occurrence & distributionGBIF · OBIS25 562 records
Environmental DNA3 datasets · 25 countries449 detections
Biotic interactionsGLoBI1 699 partners
DNA & barcodingBOLD446 specimens
02Traits & measurements
No structured trait data for this taxon yet.
04Biotic interactions1 699 partners
Every species Escherichia coli is documented to interact with — what eats it, what it eats, and the species it lives alongside. Pick a category to list every partner. Compiled from GLoBI.
acted on acts on mutual
Click a category to list every partner · hover a species for a preview
Infected byHosts & parasites1 356 partners
Veterinaerplatzvirus vv12210I84Oslovirus Lyz12581Vzw44Tequatrovirus ecombl7538Sinsheimervirus phiX17430Gequatrovirus G426Traversvirus II26Mosigvirus mar005p118Escherichia coli16Tequatrovirus RB312Tequatrovirus gee449812Tequatrovirus gee906212Enquatrovirus N410Krischvirus gec3s10Tequatrovirus T410Vequintavirus slur1610Mosigvirus JS0910Felixounavirus wV88Gequatrovirus talmos8Kayfunavirus LM33P18Lambdavirus lambda8Pbunavirus PB18Peduovirus pv12474III8Emesvirus japonicum6Emesvirus zinderi6Inovirus M136Oslovirus ArgO1456Oslovirus ov1916Qubevirus faecium6Tequatrovirus ime096Traversvirus tv933W6other taxa · 422 sp846Straboviridae · 159 sp352Autographiviridae · 99 sp202Drexlerviridae · 75 sp160Traversvirus · 61 sp128Siphoviridae · 56 sp112Dhillonvirus · 48 sp96Kagunavirus · 40 sp84Demerecviridae · 36 sp72Felixounavirus · 30 sp62Peduoviridae · 30 sp60Kuravirus · 27 sp56Lambdavirus · 23 sp46Vequintavirus · 14 sp38Chaseviridae · 15 sp30Myoviridae · 15 sp30Schitoviridae · 13 sp28Ackermannviridae · 12 sp28Phapecoctavirus · 11 sp24Oslovirus · 10 sp22Microviridae · 11 sp22Lederbergvirus · 11 sp22Asteriusvirus · 9 sp18Justusliebigvirus · 9 sp18Wifcevirus · 9 sp18Pankowvirus · 6 sp14Uetakevirus · 4 sp10Nonagvirus · 5 sp10Seuratvirus · 5 sp10Punavirus · 5 sp10Ravinvirus · 4 sp8Suspvirus · 3 sp6Inoviridae · 3 sp6Rosemountvirus · 3 sp6Sawaravirus · 1 sp4Aguilavirus · 2 sp4Deseoctovirus · 2 sp4Muvirus · 2 sp4Xuquatrovirus · 2 sp4Podoviridae · 2 sp4Seoulvirus · 2 sp4Jilinvirus · 2 sp4Kwaitsingvirus · 2 sp4Marienburgvirus · 2 sp4Shamshuipovirus · 2 sp4Wanchaivirus · 2 sp4Avunavirus · 1 sp2Buchananvirus · 1 sp2Byrnievirus · 1 sp2Casadabanvirus · 1 sp2Cuauhtlivirus · 1 sp2Tectiviridae · 1 sp2Caminolopintovirus · 1 sp2Lokivirus · 1 sp2Casjensviridae · 1 sp2Seunavirus · 1 sp2Goslarvirus · 1 sp2Leicestervirus · 1 sp2Mooglevirus · 1 sp2Murrayvirus · 1 sp2Nochtlivirus · 1 sp2Fiersviridae · 1 sp2Saikungvirus · 1 sp2Sendosyvirus · 1 sp2Wongtaivirus · 1 sp2Yautsimvirus · 1 sp2
Parasite ofHosts & parasites105 partners
Papio hamadryas12Indri indri8Avahi laniger4Canis lupus4Eulemur macaco4Eulemur rubriventer4Gorilla gorilla4Lemur catta4Macaca sinica4Presbytis vetulus4Propithecus diadema4Aepyceros melampus2Aglais io2Ailuropoda melanoleuca2Alces alces2Alligator sinensis2Amazona brasiliensis2Antechinus flavipes2Apis cerana2Aquila chrysaetos2Arctocephalus forsteri2Arctocephalus gazella2Asio otus2Athene noctua2Bison bonasus2Bos grunniens2Bos taurus2Branta canadensis2Burhinus oedicnemus2Callorhinus ursinus2Cercopithecidae · 6 sp12Cervidae · 4 sp8Phocidae · 4 sp8Bovidae · 3 sp6Phasianidae · 3 sp6Equidae · 3 sp6Felidae · 3 sp6Heteromyidae · 2 sp4Laridae · 2 sp4Cricetidae · 2 sp4Muridae · 2 sp4Procyonidae · 2 sp4Leporidae · 2 sp4Dasyuridae · 2 sp4Tapiridae · 2 sp4Ursidae · 2 sp4Camelidae · 1 sp2Phyllostomidae · 1 sp2Ciconiidae · 1 sp2Columbidae · 1 sp2Culicidae · 1 sp2Corvidae · 1 sp2Emberizidae · 1 sp2Falconidae · 1 sp2Hirundinidae · 1 sp2Hominidae · 1 sp2Achatinidae · 1 sp2Moschidae · 1 sp2Muscidae · 1 sp2Mustelidae · 1 sp2Ornithorhynchidae · 1 sp2Pandionidae · 1 sp2Passeridae · 1 sp2Petauridae · 1 sp2Phalacrocoracidae · 1 sp2Phascolarctidae · 1 sp2Didelphidae · 1 sp2Procellariidae · 1 sp2Emballonuridae · 1 sp2Callitrichidae · 1 sp2Struthionidae · 1 sp2Suidae · 1 sp2Geotrupidae · 1 sp2Delphinidae · 1 sp2Lemuridae · 1 sp2Canidae · 1 sp2Otariidae · 1 sp2
Lives on hostHosts & parasites94 partners
Canis lupus966Sus scrofa879Bos taurus630Gallus gallus600Homo sapiens600Equus caballus456Ovis aries417Felis catus405Oryctolagus cuniculus399Anas platyrhynchos375Capra hircus369Meleagris gallopavo315Mus musculus309Rattus norvegicus303Mesocricetus auratus111Columba livia81Cervus elaphus69Camelus dromedarius66Phalacrocorax carbo51Hirundo rustica48Equus asinus36Bos grunniens30Odocoileus virginianus27Anas zonorhyncha27Hypsipetes amaurotis27Panthera onca27Passer montanus27Spodiopsar cineraceus27Streptopelia orientalis27Ardenna tenuirostris24Strigidae · 4 sp36Phasianidae · 2 sp27Heteromyidae · 2 sp27Columbidae · 1 sp24Ursidae · 2 sp24Cervidae · 1 sp21Phocidae · 1 sp18Dasyuridae · 3 sp18Tapiridae · 3 sp18Mustelidae · 1 sp15Struthionidae · 1 sp15Otariidae · 1 sp15Anatidae · 3 sp15Phyllostomidae · 1 sp12Ciconiidae · 1 sp12Culicidae · 1 sp12Cricetidae · 1 sp12Pandionidae · 1 sp12Didelphidae · 1 sp12Felidae · 1 sp12Cercopithecidae · 2 sp12Apidae · 1 sp9Arionidae · 1 sp9Petauridae · 1 sp9Leporidae · 1 sp9Delphinidae · 1 sp9Laridae · 2 sp9Nymphalidae · 1 sp6Burhinidae · 1 sp6Falconidae · 1 sp6Bangiaceae · 1 sp6Amaranthaceae · 1 sp6Geotrupidae · 1 sp6Alligatoridae · 1 sp3Motacillidae · 1 sp3Accipitridae · 1 sp3Asteraceae · 1 sp3Corvidae · 1 sp3Fringillidae · 1 sp3Amaryllidaceae · 1 sp3Lutjanidae · 1 sp3Euphorbiaceae · 1 sp3Moschidae · 1 sp3Muscidae · 1 sp3Ornithorhynchidae · 1 sp3Phascolarctidae · 1 sp3Callitrichidae · 1 sp3Trachipteridae · 1 sp3Zosteropidae · 1 sp3Emballonuridae · 1 sp2
Pathogen ofHosts & parasites72 partners
Mus musculus828Homo sapiens559Gallus gallus377Anas platyrhynchos190Caenorhabditis elegans108Sus scrofa82Bos taurus62Rattus rattus48Oryctolagus cuniculus33Galleria mellonella28Escherichia coli16Chlorocebus aethiops12Mesocricetus auratus12Ovis aries9Danio rerio8Meleagris gallopavo6Drosophila melanogaster6Rattus6Felis catus5Callimico goeldii4Lemur catta4Trachypithecus cristatus4Accipiter gentilis4Accipiter nisus4Acrocephalus palustris4Anser albifrons4Ardea cinerea4Asio otus4Bombyx mori4Buteo buteo4Cervidae · 4 sp16Sylviidae · 3 sp12Corvidae · 2 sp8Columbidae · 2 sp8Paridae · 2 sp8Turdidae · 2 sp8other taxa · 3 sp7Laridae · 1 sp4Anatidae · 1 sp4Picidae · 1 sp4Emberizidae · 1 sp4Equidae · 1 sp4Muscicapidae · 1 sp4Lemuridae · 1 sp4Falconidae · 1 sp4Fringillidae · 1 sp4Hominidae · 1 sp4Indriidae · 1 sp4Sciuridae · 1 sp4Cercopithecidae · 1 sp4Passeridae · 1 sp4Phalacrocoracidae · 1 sp4Prunellidae · 1 sp4Bovidae · 1 sp4Sittidae · 1 sp4Sturnidae · 1 sp4Tytonidae · 1 sp4Otariidae · 1 sp4Canidae · 1 sp1Camelidae · 1 sp1Suidae · 1 sp1
Host toHosts & parasites33 partners
Siphoviridae312Lactococcus lactis306enterobacteria phage p1273hepatitis b virus198Bacillus megaterium174enterobacteria phage m13174enterobacteria phage p2114plasmid f70Enterobacteria phage PRD169enterobacteria phage hk02242enterobacteria phage n1533enterobacteria phage t121enterobacteria phage bz1315enterobacteria phage ike12enterobacteria phage ms212Enterobacteria phage If19enterobacteria phage hk979Alphatrevirus alpha36Enterobacteria phage St-16Uetakevirus phiV106enterobacteria phage phieco326Dickeya chrysanthemi3Enterobacteria phage T73Mycobacterium avium3enterobacteria phage i2-23enterobacteria phage k1-53enterobacteria phage k1e3enterobacteria phage mu3enterobacteria phage sv143enterobacteria phage t53other taxa · 2 sp6Dictyosteliaceae · 1 sp1
Hemiparasite ofHosts & parasites31 partners
Zalophus californianus22Phoca vitulina16Neomonachus schauinslandi12Mirounga angustirostris10Rusa unicolor10Papio hamadryas8Sus scrofa5Arctocephalus gazella4Cervus elaphus4Odocoileus virginianus4Callorhinus ursinus4Aepyceros melampus2Alces alces2Arctocephalus forsteri2Bison bonasus2Capreolus capreolus2Equus grevyi2Eulemur macaco2Halichoerus grypus2Indri indri2Lemur catta2Macaca sinica2Mustela vison2Nasua narica2Procyon lotor2Puma concolor2Rupicapra rupicapra2Semnopithecus priam2Semnopithecus vetulus2Ursus americanus2Canidae · 1 sp2
Endoparasite ofHosts & parasites3 partners
Preyed on byFood web2 partners
Monas4Ochromonas danica4
Interacts withAssociations2 partners
Co-occurs withAssociations1 partner
05DNA & barcoding446 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Escherichia coli has left across the world's sequence archives.
At a glance
DNA specimens446
Marker genes2
eDNA detections449
Countries25
The DNA barcodethe species' typical barcode, built from every sequenced specimen
COI-5P666 bp consensus444 specimens
ACGT
▸ drag or hover over the strip to read any position — letter and how much it varies
Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.
Where individuals differ — all 11 variable positions, in barcode order
252Tmostly conserved
261Gmostly conserved
267Cmostly conserved
309Cmostly conserved
373Cmostly conserved
393Cmostly conserved
430Tmostly conserved
447Tvariable
489Cmostly conserved
561Cmostly conserved
609Tmostly conserved
ATGTTCGGAAAATTATCACTTGATGCAGTCCCGTTCCATGAACCTATCGTCATGGTTACGATCGCTGGCATTATTTTGGGAGGTCTGGCG …
Variant network
Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 44 variants.
Diversity (π)0.51%
Haplotypes44
BINs0
Most divergent pair2.0%
N.AmericaAsiaEuropeAfricaOtherS.America
Closest relatives by DNA barcode
The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P16S
animal barcoderibosomal
08Occurrence & distribution
Record type25 562 records
Wild obs. + sensor4 144
Museum / vouchered21 371
Cultivated / captive10
Other37
Origin
Introduced103
Range
Area of Occupancy AOO10 876 km²
Depth
0–200 m sunlit91
200–1000 m twilight2
1–4 km midnight12
>4 km abyssal1
median 10 m · max 5 283 m · 106 records with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy74% within 1 km
≤100 m 11≤1 km 6>10 km 6
23 georeferenced · 4 121 without coordinates
Open the mapobservation + sensor4 144
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy100% within 1 km
≤1 km 2
2 georeferenced · 21 369 without coordinates
Open the institutions mapphysical evidence21 371
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤100 m 2
2 georeferenced · 8 without coordinates
Open the mapnot free-living10
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
| Institution | Specimens |
|---|---|
| Instituto Nacional de Salud (INS)location not on record | 103 |
| Instituto Amazónico de Investigaciones Científicas SINCHIlocation not on record | 19 |
| Universidad Nacional de Colombialocation not on record | 3 |
| Agri Biochem Research Lablocation not on record | 2 |
4 institutions · 127 of 21 371 vouchered records shown · 20 770 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA449 detections
Where the DNA of Escherichia coli was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found449
Studies independent surveys3
Countries25
Verifiable raw sequence linked3
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 449 detections have coordinates
Open the map25 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median22.8 °C 12.5–25.9
Seasonal swing summer↔winter10.4 °C
Max temp (day)27.1 °C 18.4–31.4
Min temp (night)18.5 °C 8.20–21.3
Precipitation79.6 mm/mo 0.5–180
Air humidity59.6 % 51.6–63.1
Moisture balance-38.4 mm/mo -122–60.8
Vapour deficit1,131 Pa 733–1,488
Wind speed2.50 m/s 1.70–5.80
Cloud cover34.6 % 24.9–54.7
CHELSA 1981–2010, ~9 km grid, at location & month of 199 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.