Eulemur rubriventer

(I.Geoffroy Saint-Hilaire, 1850) · species

image placeholder — illustration coming later

Animalia/Chordata/Mammalia/Primates/Lemuridae/Eulemur

At a glance

Occurrence records333

Data sources12

Biological traits22

DNA specimens22

eDNA detections12

Sources12 archives

Databases and archives Eulemur rubriventer's data was compiled from.

WikipediaWikimedia Foundation15 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility333 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements4 literature sources22 traits

Occurrence & distributionGBIF333 records

Environmental DNA1 datasets · 0 countries12 detections

DNA & barcodingBOLD22 specimens

Genome at a glanceGoaT · NCBI2.5 Gbp

01Narrative

male female juvenile The red-bellied lemur (Eulemur rubriventer) is a medium-sized strepsirrhine primate with a luxuriant chestnut brown coat. This lemur is endemic to eastern Madagascan rainforests and is distinguished by patches of white skin below the eyes, giving rise to a "teardrop" effect, particularly conspicuous in the male.Russell Mittermeier et al., Lemurs of Madagascar, Conservation Press (2006) The species, first identified in 1850, exhibits diurnal behaviour and marked sexual dimorphism. The red-bellied lemur has been studied extensively since the mid-1980s, primarily in Ranomafana National Park.B. Meier, Preliminary report of a field study of Lemur rubriventer and Hapalemar simus (nov. species) in Ranomafana-Itandiana (1986-87) Report to Ministry of Scientific Research, 312 Faritany Fianaransoa, Antananarivo, MadagascarC. Dague and J.J. Peter, Observations sur le Lemur ruriventer dans son milieu naturel, In: L. Rakotovao, L’Equilibre des Ecosystems Forestiers a Madagascar: Actes d’un seminaire international IUCN, Gland Switz and Cambridge (1988) This lemur species is designated as vulnerable according to the IUCN Red List, due to threats endangering habitats from slash-and-burn agriculture in Madagascar.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPanTHERIAAnAgeAmnioteDBEltonTraits

Size & morphology3

Body mass2 015 g

⚠ sources differ — PanTHERIA: 2 015 g · AnAge: 2 192 g · AmnioteDB: 1 765 g · EltonTraits: 1 400 g

Head body length405 mm

SVL42.74 cm

Life cycle & reproduction7

Age at maturity (male)1 350 days

Age at sexual maturity566 days

⚠ sources differ — PanTHERIA: 566 days · AnAge: 646 days · AmnioteDB: 566 days

Gestation127 days

⚠ sources differ — PanTHERIA: 127 days · AnAge: 120 days · AmnioteDB: 130 days

Litter size1.01

Max. longevity380 months

⚠ sources differ — AnAge: 380 months · AmnioteDB: 247 months

Neonate mass84.97 g

⚠ sources differ — PanTHERIA: 84.97 g · AnAge: 76.5 g · AmnioteDB: 85.5 g

Weaning age151 days

Diet & foraging4

Breadth4

Fruit30 %

Plant other70 %

Trophic levelomnivore

Habitat & environment2

Habitat breadth1

Terrestriality2.00

Physiology & chemistry2

Precipitation mean178 mm

Temperature mean194 decidegC

Other traits4

Activity cycle2.00

Foraging stratumAr

Home range0.13 km²

Population density30 /km²

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eulemur rubriventer has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes11

eDNA detections12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P630 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

42Gvariable

195Gmostly conserved

300Gmostly conserved

366Gmostly conserved

522Gmostly conserved

555Amostly conserved

ATCGGAACTCTTTACCTCTTATTTGGGGCTTGAGCAGGCATGGTAGGAACAGCTCTTAGCCTTTTAATTCGAGCAGAACTTGGTCAACCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.26%

Haplotypes6

BIN1

Most divergent pair0.63%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eulemur mongozsame genus4.6%Eulemur macacosame genus5.6%Eulemur fulvussame genus5.7%Lemur cattasame family12.8%Varecia variegatasame family15.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_026098 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Eulemur rubriventer carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 533 020 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Eulemur rubriventer2.53 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 50 n = 25

Chromosome records50–502n range50median50mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 502×GoaT · Animal Chromosome Counts Database · GoaT · Animal Genome Size Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Animal Genome Size Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

07Deep time~6.91 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin6.91 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

How it livedPBDB

Environmentterrestrial

Life habitarboreal

Dietfrugivore, herbivore

Motilityactively mobile

Compositionhydroxyapatite

Reproductionviviparous

08Occurrence & distribution

Record type333 records

Wild obs. + sensor306

Museum / vouchered27

Origin

Native10

Range

Area of Occupancy AOO908 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy2% within 1 km

≤100 m 1≤1 km 3≤10 km 1>10 km 222

227 georeferenced · 79 without coordinates

Open the mapobservation + sensor306

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence27

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	22
Geneva, CH	2
Stockholm, SE	2
Duke Lemur Center Museum of Natural Historylocation not on record	1

4 institutions · 27 of 27 vouchered records shown

09Environmental DNA12 detections

Where the DNA of Eulemur rubriventer was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)