Eulemur fulvus

(É.Geoffroy Saint-Hilaire, 1796) · species

image placeholder — illustration coming later

Animalia/Chordata/Mammalia/Primates/Lemuridae/Eulemur

At a glance

Occurrence records1 772

Data sources11

Biological traits26

DNA specimens25

eDNA detections5

Sources11 archives

Databases and archives Eulemur fulvus's data was compiled from.

WikipediaWikimedia Foundation13 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 772 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements4 literature sources26 traits

Occurrence & distributionGBIF1 772 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD25 specimens

Genome at a glanceGoaT · TreeOfSex · NCBI3.3 Gbp

01Narrative

The common brown lemur (Eulemur fulvus) is a species of lemur in the family Lemuridae. It is found in Madagascar and has been introduced to Mayotte.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPanTHERIAAnAgeAmnioteDBEltonTraits

Size & morphology3

Body mass2 377 g

⚠ sources differ — PanTHERIA: 2 377 g · AnAge: 2 485 g · AmnioteDB: 2 419 g · EltonTraits: 3 150 g

Head body length470 mm

SVL48.48 cm

Life cycle & reproduction8

Age at maturity (male)633 days

⚠ sources differ — AnAge: 633 days · AmnioteDB: 548 days

Age at sexual maturity792 days

⚠ sources differ — PanTHERIA: 792 days · AnAge: 509 days · AmnioteDB: 648 days

Gestation121 days

Litter size1.1

Litters per year2 /year

Max. longevity444 months

Neonate mass74.99 g

⚠ sources differ — PanTHERIA: 74.99 g · AnAge: 73 g · AmnioteDB: 80.85 g

Weaning age135 days

⚠ sources differ — PanTHERIA: 135 days · AmnioteDB: 153 days

Diet & foraging4

Breadth3

Fruit30 %

Plant other70 %

Trophic levelherbivore

Habitat & environment2

Habitat breadth1

Terrestriality2.00

Physiology & chemistry4

Body temperature310 K

Metabolic rate4.24 W

Precipitation mean156 mm

Temperature mean214 decidegC

Other traits5

Activity cycle2.00

Foraging stratumAr

Home range0.05 km²

Interbirth interval548 days

Population density221 /km²

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eulemur fulvus has left across the world's sequence archives.

At a glance

DNA specimens25

BINs1

Marker genes11

eDNA detections5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P603 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

ATTCGAGCAGAACTTGGTCAACCCGGGGCTTTATTAGGAGATGACCAAATCTACAATGTAATCGTAACAGCTCATGCTTTCGTTATAATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eulemur mongozsame genus5.4%Eulemur rubriventersame genus5.7%Eulemur macacosame genus7.0%Lemur cattasame family14.4%Varecia variegatasame family14.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_012769 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBs-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · TreeOfSex · NCBI

The complete instruction manual Eulemur fulvus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size3 281 190 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Eulemur fulvus3.28 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Chromosome records48–602n range54median48mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 482×GoaT · Animal Chromosome Counts Database · GoaT · Animal Genome Size Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Animal Genome Size Database — ↗

2n 602×GoaT · Animal Chromosome Counts Database · TreeOfSex · vert

GoaT · Animal Chromosome Counts Database — ↗

TreeOfSex · vert — Pardo-Manuel de Villena F., Sapienza C. (2001) Female meiosis drives karyotype evolution in mammals. Genetics 159: 1179-1189. ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness58.2% BUSCO

07Deep time~3.29 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin3.29 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

How it livedPBDB

Environmentterrestrial

Life habitarboreal

Dietfrugivore, herbivore

Motilityactively mobile

Compositionhydroxyapatite

Reproductionviviparous

08Occurrence & distribution

Record type1 772 records

Wild obs. + sensor1 754

Museum / vouchered18

Origin

Native13

Range

Area of Occupancy AOO1 652 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy12% within 1 km

≤100 m 114≤1 km 40≤10 km 610>10 km 525

1 289 georeferenced · 465 without coordinates

Open the mapobservation + sensor1 754

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 6>10 km 5

11 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence18

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	6
Stockholm, SE	5
Geneva, CH	4
Duke Lemur Center Museum of Natural Historylocation not on record	1
South Kensington, GB	1
Berkeley, US	1

6 institutions · 18 of 18 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Eulemur fulvus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eulemur fulvus

At a glance

Sources11 archives

Size & morphology3

Life cycle & reproduction8

Diet & foraging4

Habitat & environment2

Physiology & chemistry4

Other traits5

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

At a glance

When this lineage existed

How it livedPBDB

Record type1 772 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 6 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 772 records