Danio rerio

(Hamilton, 1822) · species

image placeholder — illustration coming later

Animalia/Chordata/Cypriniformes/Cyprinidae/Danio

At a glance

Occurrence records164

Data sources12

Biological traits0

DNA specimens114

eDNA detections110

Sources12 archives

Databases and archives Danio rerio's data was compiled from.

WikipediaWikimedia Foundation19 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility164 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI110 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics114 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF164 records

Environmental DNA1 datasets · 5 countries110 detections

DNA & barcodingBOLD114 specimens

Genome at a glanceGoaT · NCBI1.7 Gbp

01Narrative

The zebrafish (Danio rerio) is a freshwater fish belonging to the minnow family (Cyprinidae) of the order Cypriniformes. Native to South Asia, it is a popular aquarium fish, frequently sold under the trade name zebra danio (and thus often called a "tropical fish" although both tropical and subtropical). It is also found in private ponds. The zebrafish is an important and widely used vertebrate model organism in scientific research, for example in drug development, in particular pre-clinical development. It is also notable for its regenerative abilities, and has been modified by researchers to produce many transgenic strains.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition1 compounds

Compounds documented for Danio rerio across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

pteridine alkaloids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
2-amino-6-lactoyl-7,8-dihydropteridin-4(3H)-one		present	LOTUS

05DNA & barcoding114 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Danio rerio has left across the world's sequence archives.

At a glance

DNA specimens114

BINs4

Marker genes12

eDNA detections110

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus103 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

39Gmostly conserved

99Tmostly conserved

108Cvariable

333Tmostly conserved

504Avariable

585Cmostly conserved

603Gmostly conserved

CTGTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGGACCGCATTAAGCCTCTTAATCCGAGCTGAACTTAGCCAACCAGGAGCACTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes16

BINs4

Most divergent pair18.6%

AsiaAfricaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Danio dangilasame genus10.1%Danio feegradeisame genus10.4%Danio tinwinisame genus10.6%Danio nigrofasciatussame genus10.8%Danio assamilasame genus10.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6Rho

animal barcodemitochondrialmarker

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_002333 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBmt-rnr1mt-rnr2

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Danio rerio carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 740 840 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Danio rerio1.74 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Chromosome records48–482n range48median48mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 482×GoaT · Animal Chromosome Counts Database · GoaT · Animal Genome Size Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Animal Genome Size Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelComplete Genome

Completeness97.7% BUSCO

08Occurrence & distribution

Record type164 records

Wild obs. + sensor51

Museum / vouchered113

Range

Area of Occupancy AOO452 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 16≤1 km 3≤10 km 5>10 km 12

36 georeferenced · 15 without coordinates

Open the mapobservation + sensor51

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤100 m 1≤1 km 1≤10 km 11>10 km 4

17 georeferenced · 96 without coordinates

Open the institutions mapphysical evidence113

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Stockholm, SE	37
CASlocation not on record	15
FishBaselocation not on record	10
Centro de Investigaciones Biológicas, Universidad Autónoma del Estado de Moreloslocation not on record	5
Ann Arbor, US	4
Montgomery, US	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
New Haven, US	1
Vancouver, CA	1
PUC-RSlocation not on record	1
Juriquilla, MX	1

11 institutions · 79 of 113 vouchered records shown · 34 without an institution code

09Environmental DNA110 detections

Where the DNA of Danio rerio was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found110

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 110 detections have coordinates

Open the map5 countries0

Water

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 10.3–28.5

Seasonal swing summer↔winter13.2 °C

Max temp (day)30.5 °C 13.7–31.4

Min temp (night)19.3 °C 5.80–26.2

Precipitation183 mm/mo 47.3–487

Air humidity61.9 % 52.0–68.6

Moisture balance52.2 mm/mo

Vapour deficit1,275 Pa 409–1,616

Wind speed1.80 m/s

Cloud cover25.8 % 21.0–50.7

CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)