Acrocephalus palustris

(Bechstein, 1798) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Passeriformes/Acrocephalidae/Acrocephalus

At a glance

Occurrence records594 801

Data sources12

Biological traits32

DNA specimens66

eDNA detections66

Sources12 archives

Databases and archives Acrocephalus palustris's data was compiled from.

WikipediaWikimedia Foundation14 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility594 801 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI66 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics66 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADWarticle

Traits & measurements4 literature sources32 traits

Occurrence & distributionGBIF594 801 records

Environmental DNA1 datasets · 4 countries66 detections

DNA & barcodingBOLD66 specimens

Genome at a glanceGoaT · NCBI≈1.1 Gbp

01Narrative

Marsh warblers are small passerine birds with a subtly rounded head, complemented by upperparts with a greyish-brown hue with a slightly warmer tone compared to similar species. The throat stands out as a crisp, pure white, which gently transitions into soft, creamy-colored underparts. Their legs are typically a pale flesh tone or a yellowish-pink, adding to its delicate appearance. Notably, marsh warbler upperparts tend to be brighter and more vibrant than those of the closely related reed warbler, providing a useful point of differentiation when identifying the species in the field. The average weight of adult marsh warblers ranges from 11.89 grams in spring to 12.67 grams in autumn. The average wingspan of reed warblers ( Acrocephalus scirpaceus ) and sedge warblers ( Acrocephalus schoenobaenus ), which are nearly morphologically identical to marsh warblers, is approximately 194.6 mm.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBAnAgeAVONETEltonTraits

Size & morphology13

Beak depth3.3 mm

Beak length (culmen)16.1 mm

Beak length (nares)8.2 mm

Beak width3.3 mm

Body mass11.5 g

Body mass (female)11.95 g

Body mass (male)12.6 g

Hand-wing index27.9

Kipp's distance19.2 mm

Secondary length49.6 mm

Tail length56.5 mm

Tarsus length21.3 mm

Wing length68.6 mm

Life cycle & reproduction8

Age at maturity (male)365 days

Age at sexual maturity365 days

Egg mass1.85 g

Fledging age12 days

Incubation11.5 days

Litter size4.41

Litters per year1 /year

Max. longevity118 months

Diet & foraging6

Fruit20 %

Invertebrate80 %

Midhigh50 %

Trophic levelcarnivore

Trophic nicheInvertivore

Understory50 %

Habitat & environment4

HabitatShrubland

Migration3.0

Primary lifestyleInsessorial

Range size5 996 673 km²

Physiology & chemistry1

Metabolic rate0.203 W

05DNA & barcoding66 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrocephalus palustris has left across the world's sequence archives.

At a glance

DNA specimens66

BINs1

Marker genes1

eDNA detections66

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P603 bp consensus66 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

21Gmostly conserved

111Gmostly conserved

471Cmostly conserved

CTTCTTATTCGAGCAGAGCTGGGCCAACCTGGCGCCCTCCTGGGAGACGATCAGGTATACAACGTGGTCGTTACAGCCCATGCATTCGTG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 46 variants.

Diversity (π)0.39%

Haplotypes46

BIN1

Most divergent pair0.99%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrocephalus scirpaceussame genus8.3%Acrocephalus baeticatussame genus8.3%Acrocephalus dumetorumsame genus9.3%Acrocephalus agricolasame genus9.3%Acrocephalus schoenobaenussame genus10.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acrocephalus palustris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 105 223 200 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acrocephalus palustris1.11 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

07Deep time~3.38 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin3.38 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

How it livedPBDB

Environmentterrestrial

Life habitground dwelling, solitary

Dietcarnivore

Motilityactively mobile

Compositionhydroxyapatite

Reproductionoviparous, dispersal=direct/internal,mobile

Ontogenyaccretion,modification of parts

08Occurrence & distribution

Record type594 801 records

Wild obs. + sensor593 183

Museum / vouchered1 301

Cultivated / captive32

Other285

Origin

Native545

Range

Area of Occupancy AOO230 284 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 52 366≤1 km 207 512≤10 km 169 985>10 km 3 078

432 941 georeferenced · 160 242 without coordinates

Open the mapobservation + sensor593 183

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 18≤1 km 494≤10 km 145>10 km 22

679 georeferenced · 622 without coordinates

Open the institutions mapphysical evidence1 301

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy44% within 1 km

≤100 m 6≤1 km 8≤10 km 15>10 km 3

32 georeferenced

Open the mapnot free-living32

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions26 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zoological Museum, Moscow Lomonosov State Universitylocation not on record	285
Salzburg, AT	177
Brussels, BE	147
RBINS-Scientific Heritagelocation not on record	108
NHMOlocation not on record	95
Geneva, CH	56
Provincia di Livornolocation not on record	49
Washington, US	40
Copenhagen, DK	33
South Kensington, GB	30
Seattle, US	28
Ann Arbor, US	24
New Haven, US	18
Philadelphia, US	15
Helsinki, FI	15
Cambridge, US	12
Liverpool, GB	10
MZLUlocation not on record	10
Louisiana State University, Museum of Zoologylocation not on record	9
Stockholm, SE	8
Frankfurt am Main	7
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	7
Toronto, CA	6
Edmonton, CA	6
Paris, FR	5
Philadelphia, US	5
Natural History Museum Rotterdamlocation not on record	5
Texas Cooperative Wildlife Collectionlocation not on record	4
KU Leuvenlocation not on record	3
Chicago, US	3
Gothenburg, SE	2
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
Berkeley, US	2
Auckland, NZ	1
Bourges, FR	1
Ugentlocation not on record	1
	1
IMEDEAlocation not on record	1
Barcelona, ES	1
Natural History Museum, Aarhus Denmarklocation not on record	1

40 institutions · 1 233 of 1 301 vouchered records shown · 68 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA66 detections

Where the DNA of Acrocephalus palustris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found66

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 66 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.1 °C 14.5–17.9

Seasonal swing summer↔winter20.2 °C

Max temp (day)20.6 °C 18.4–22.9

Min temp (night)12.3 °C 9.70–14.3

Precipitation79.9 mm/mo 74.8–86.5

Air humidity58.3 % 57.8–61.5

Moisture balance-38.5 mm/mo -55.0–-32.8

Vapour deficit782 Pa 666–897

Wind speed2.80 m/s 2.30–4.00

Cloud cover39.5 % 31.7–43.8

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acrocephalus palustris

At a glance

Sources12 archives

Size & morphology13

Life cycle & reproduction8

Diet & foraging6

Habitat & environment4

Physiology & chemistry1

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

At a glance

When this lineage existed

How it livedPBDB

Record type594 801 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions26 of 40 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type594 801 records