Acrocephalus agricola

(Jerdon, 1845) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Passeriformes/Acrocephalidae/Acrocephalus

At a glance

Occurrence records30 029

Data sources11

Biological traits24

DNA specimens8

eDNA detections8

Sources11 archives

Databases and archives Acrocephalus agricola's data was compiled from.

WikipediaWikimedia Foundation13 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility30 029 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources24 traits

Occurrence & distributionGBIF30 029 records

Environmental DNA1 datasets · 3 countries8 detections

DNA & barcodingBOLD8 specimens

Genome at a glanceGoaT · NCBI≈1.2 Gbp

01Narrative

Der Feldrohrsänger (Acrocephalus agricola, Syn.: Sylvia (acrocephalus) agricola) ist ein Singvogel aus der Gattung der Rohrsänger (Acrocephalus) und der Familie der Rohrsängerartigen (Acrocephalidae).Feldrohrsänger, in Avibase – Die Weltvogel-Datenbank. Abgerufen am . Verbreitung des Feldrohrsängers: Der Vogel kommt als Sommervogel im zentralen Eurasien vor und überwintert im südlichen Asien. Das Verbreitungsgebiet umfasst mit niedrigem Schilf, auch mit Rohrkolben und Tamarisken bewachsene offene Lebensräume, gerne in der Nähe von Seen und Flusstälern. Außerhalb des Brutgebietes benötigt die Art feuchte und dicht bedeckte Flächen wie Reisfelder, Zuckerrohrfelder.A. Dyrcz: Paddyfield Warbler (Acrocephalus agricola), version 1.0. In: J. del Hoyo, A. Elliott, J. Sargatal, D. A. Christie und E. de Juana (Herausgeber): Birds of the World. 2020, Cornell Lab of Ornithology, Ithaca, NY, USA. Paddyfield Warbler Das Artepitheton kommt von und .J. A. Jobling: A Dictionary of Scientific Bird Names. Oxford University Press. 1991. ISBN 0-19-854634-3. Früher wurde die Art als konspezifisch mit dem Mandschurenrohrsänger (A. tangorum) und/oder dem Strauchrohrsänger (A. concinens) angesehen.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBAVONETEltonTraits

Size & morphology13

Beak depth2.8 mm

Beak length (culmen)13.6 mm

Beak length (nares)7.8 mm

Beak width3.2 mm

Body mass9.55 g

Body mass (female)10.9 g

Body mass (male)11.2 g

Hand-wing index18.4

Kipp's distance10.1 mm

Secondary length44.7 mm

Tail length54.9 mm

Tarsus length21.1 mm

Wing length55.2 mm

Life cycle & reproduction2

Egg mass1.47 g

Litter size4.5

Diet & foraging5

Ground50 %

Invertebrate100 %

Trophic levelcarnivore

Trophic nicheInvertivore

Water around surface50 %

Habitat & environment4

HabitatWetland

Migration3.0

Primary lifestyleInsessorial

Range size6 560 154 km²

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrocephalus agricola has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections8

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P659 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.23%

Haplotypes1

BIN1

Where individuals differ — all 5 variable positions, in barcode order

3Amostly conserved

70Cmostly conserved

80Cmostly conserved

144Gmostly conserved

634Gmostly conserved

CTATACCTAATCTTTGGTGCATGAGCCGGAATAGTAGGCACCGCCCTCAGCCTCCTCATTCGAGCAGAACTAGGCCAACCTGGCGCCCTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrocephalus dumetorumsame genus8.5%Acrocephalus baeticatussame genus8.8%Acrocephalus palustrissame genus9.3%Acrocephalus scirpaceussame genus9.5%Hippolais polyglottasame family10.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acrocephalus agricola carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 157 302 558 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acrocephalus agricola1.16 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

07Deep time~3.59 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin3.59 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type30 029 records

Wild obs. + sensor29 820

Museum / vouchered208

Cultivated / captive1

Origin

Native27

Range

Area of Occupancy AOO20 932 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 1 168≤1 km 1 505≤10 km 1 304>10 km 92

4 069 georeferenced · 25 751 without coordinates

Open the mapobservation + sensor29 820

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy3% within 1 km

≤1 km 5≤10 km 146>10 km 4

155 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence208

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ann Arbor, US	26
Zoological Museum, Moscow Lomonosov State Universitylocation not on record	21
Seattle, US	14
NHMOlocation not on record	13
Philadelphia, US	4
Wuzhou, CN	4
New Haven, US	2
Cambridge, US	2
Washington, US	2
Toronto, CA	2
Stockholm, SE	1
University of Oslo, Natural History Museumlocation not on record	1
Helsinki, FI	1
Geneva, CH	1
Institute of Plant and Animal Ecology UB RASlocation not on record	1
Los Angeles, US	1
BG-NMNHSlocation not on record	1

17 institutions · 97 of 208 vouchered records shown · 111 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA8 detections

Where the DNA of Acrocephalus agricola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.8 °C 13.5–21.2

Seasonal swing summer↔winter13.6 °C

Max temp (day)19.5 °C 14.3–23.6

Min temp (night)15.9 °C 12.5–18.4

Precipitation91.7 mm/mo 33.2–138

Air humidity60.8 % 56.7–63.8

Moisture balance-42.6 mm/mo -109–43.0

Vapour deficit817 Pa 573–1,077

Wind speed5.00 m/s 3.40–6.90

Cloud cover40.4 % 29.0–48.7

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acrocephalus agricola

At a glance

Sources11 archives

Size & morphology13

Life cycle & reproduction2

Diet & foraging5

Habitat & environment4

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

At a glance

When this lineage existed

Record type30 029 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 17 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type30 029 records