Renia adspergillus

Bosc · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Renia

At a glance

Occurrence records2 100

Data sources7

Biological traits0

DNA specimens255

eDNA detections275

Sources7 archives

Databases and archives Renia adspergillus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 100 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI275 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics255 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 100 records

Environmental DNA1 datasets · 2 countries275 detections

DNA & barcodingBOLD255 specimens

01Narrative

Renia adspergillus, the gray renia or speckled renia moth, is a litter moth of the family Erebidae. The species was first described by Louis Augustin Guillaume Bosc in 1800. It is found in North America from Michigan to Quebec and south to Louisiana and Florida. The wingspan is about 25 mm. There are multiple generations in the southeast. Larvae feed beneath a web of silk.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding255 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Renia adspergillus has left across the world's sequence archives.

At a glance

DNA specimens255

BINs1

Marker genes1

eDNA detections275

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus156 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

577Gvariable

580Cvariable

AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCCTTAAGATTATTAATTCGAGCTGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.29%

Haplotypes9

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Renia factiosalissame genus4.0%Renia discoloralissame genus4.1%Renia flavipunctalissame genus4.9%Renia fraternalissame genus5.0%Renia sobrialissame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 100 records

Wild obs. + sensor1 732

Museum / vouchered368

Range

Area of Occupancy AOO4 728 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 893≤1 km 303≤10 km 89>10 km 129

1 414 georeferenced · 318 without coordinates

Open the mapobservation + sensor1 732

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 2≤1 km 25≤10 km 30>10 km 17

74 georeferenced · 294 without coordinates

Open the institutions mapphysical evidence368

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	84
Mississippi State, US	67
East Lansing, US	22
CUlocation not on record	18
Cornell University Insect Collectionlocation not on record	14
New Haven, US	11
Cambridge, US	9
Cleveland Museum of Natural History, OH (CLEV)location not on record	9
University of Alabamalocation not on record	2
UDlocation not on record	2
Biodiversity Institute of Ontariolocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1

12 institutions · 240 of 368 vouchered records shown · 128 without an institution code

09Environmental DNA275 detections

Where the DNA of Renia adspergillus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found275

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 275 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.4. Temperate ForestForestUrbanMixed habitatGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.1 °C 18.9–22.5

Seasonal swing summer↔winter26.2 °C

Max temp (day)25.1 °C 24.3–27.7

Min temp (night)17.8 °C 14.1–18.5

Precipitation92.9 mm/mo 91.6–123

Air humidity58.1 % 56.5–59.3

Moisture balance-54.6 mm/mo -64.5–-27.2

Vapour deficit1,051 Pa 929–1,158

Wind speed2.80 m/s 2.30–4.00

Cloud cover39.5 % 32.6–41.0

CHELSA 1981–2010, ~9 km grid, at location & month of 270 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Renia adspergillus

At a glance

Sources7 archives

At a glance

Record type2 100 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 100 records