Renia discoloralis

Guenée, 1854 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Renia

At a glance

Occurrence records1 709

Data sources7

Biological traits0

DNA specimens83

eDNA detections92

Sources7 archives

Databases and archives Renia discoloralis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 709 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI92 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics83 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 709 records

Environmental DNA1 datasets · 2 countries92 detections

DNA & barcodingBOLD83 specimens

01Narrative

Renia discoloralis, the discolored renia, is a litter moth of the family Erebidae. The species was first described by Achille Guenée in 1854. It is found in the United States from Missouri to southern New England, south to at least North Carolina and possibly Florida and Texas, but this might be an unnamed relative. The wingspan is 35–45 mm. Adults are on wing from July to August. There is one generation per year. The larvae feed on detritus, including dead leaves.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding83 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Renia discoloralis has left across the world's sequence archives.

At a glance

DNA specimens83

BINs1

Marker genes1

eDNA detections92

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus82 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

10Cvariable

28Avariable

34Cvariable

79Avariable

91Cvariable

139Avariable

287Cvariable

364Cvariable

541Gvariable

628Gvariable

637Cvariable

AACTTTATACTTTATTTTTGGAATTTGAGCAGGCATAGTAGGAACTTCCTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.87%

Haplotypes11

BIN1

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Renia factiosalissame genus4.0%Renia adspergillussame genus4.1%Renia flavipunctalissame genus4.3%Renia fraternalissame genus4.6%Renia pulverosalissame genus4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 709 records

Wild obs. + sensor1 301

Museum / vouchered408

Range

Area of Occupancy AOO3 972 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 650≤1 km 236≤10 km 90>10 km 110

1 086 georeferenced · 215 without coordinates

Open the mapobservation + sensor1 301

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤100 m 4≤1 km 34≤10 km 136>10 km 37

211 georeferenced · 197 without coordinates

Open the institutions mapphysical evidence408

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	119
Mississippi State, US	40
National Biodiversity Institute, Costa Ricalocation not on record	35
East Lansing, US	28
Cambridge, US	22
Cleveland Museum of Natural History, OH (CLEV)location not on record	21
CUlocation not on record	14
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	10
Colorado State Universitylocation not on record	9
Georgia Museum of Natural Historylocation not on record	7
St. Paul, US	7
OSUClocation not on record	5
University of Alberta Museums (UAM)location not on record	4
Cornell University Insect Collectionlocation not on record	4
UDlocation not on record	3
Ciudad de México, MX	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Washington, US	2
San Francisco, US	1
Toronto, CA	1
University of California, Davislocation not on record	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
University of Marylandlocation not on record	1

23 institutions · 339 of 408 vouchered records shown · 69 without an institution code

09Environmental DNA92 detections

Where the DNA of Renia discoloralis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found92

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 92 detections have coordinates

Open the map2 countries0

Forest1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.5 °C 17.5–25.1

Seasonal swing summer↔winter19.7 °C

Max temp (day)26.7 °C 21.9–29.9

Min temp (night)18.5 °C 13.3–23.7

Precipitation114 mm/mo 84.8–173

Air humidity60.2 % 56.9–64.0

Moisture balance-28.3 mm/mo -61.9–69.4

Vapour deficit1,063 Pa 802–1,285

Wind speed2.90 m/s 1.90–5.30

Cloud cover35.7 % 28.2–42.9

CHELSA 1981–2010, ~9 km grid, at location & month of 86 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Renia discoloralis

At a glance

Sources7 archives

At a glance

Record type1 709 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 709 records