Renia fraternalis

Smith, 1895 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Renia

At a glance

Occurrence records298

Data sources7

Biological traits0

DNA specimens80

eDNA detections77

Sources7 archives

Databases and archives Renia fraternalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility298 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI77 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics80 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF298 records

Environmental DNA1 datasets · 2 countries77 detections

DNA & barcodingBOLD80 specimens

01Narrative

Renia fraternalis, the fraternal renia, is a litter moth of the family Erebidae. The species was first described by J. B. Smith in 1895. It is found in North America, including New York, Oklahoma, Arkansas, South Carolina and Florida. The wingspan is about 25 mm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding80 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Renia fraternalis has left across the world's sequence archives.

At a glance

DNA specimens80

BINs2

Marker genes1

eDNA detections77

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus77 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

38Gmostly conserved

46Cmostly conserved

100Amostly conserved

220Cmostly conserved

229Gmostly conserved

268Tmostly conserved

287Tmostly conserved

300Gmostly conserved

302Amostly conserved

304Tmostly conserved

305Gmostly conserved

307Amostly conserved

310Amostly conserved

355Cmostly conserved

362Gmostly conserved

373Tmostly conserved

386Tmostly conserved

390Cmostly conserved

406Tmostly conserved

506Gmostly conserved

607Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACCTCTTTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.89%

Haplotypes11

BINs2

Most divergent pair3.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Renia salusalissame genus2.0%Renia nemoralissame genus3.3%Renia factiosalissame genus3.8%Renia discoloralissame genus4.6%Renia hutsonisame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type298 records

Wild obs. + sensor82

Museum / vouchered216

Range

Area of Occupancy AOO588 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 28≤1 km 16≤10 km 12>10 km 3

59 georeferenced · 23 without coordinates

Open the mapobservation + sensor82

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤1 km 16≤10 km 68>10 km 11

95 georeferenced · 121 without coordinates

Open the institutions mapphysical evidence216

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	53
East Lansing, US	41
Cambridge, US	19
New Haven, US	12
St. Paul, US	12
ASUlocation not on record	9
CUlocation not on record	7
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	5
Washington, US	2
Centre for Biodiversity Genomicslocation not on record	1

10 institutions · 161 of 216 vouchered records shown · 55 without an institution code

09Environmental DNA77 detections

Where the DNA of Renia fraternalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found77

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 77 detections have coordinates

Open the map2 countries0

1. Forest & WoodlandWoodedForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 14.2–27.1

Seasonal swing summer↔winter16.0 °C

Max temp (day)29.8 °C 19.6–31.8

Min temp (night)20.6 °C 8.80–23.1

Precipitation141 mm/mo 95.7–238

Air humidity60.8 % 58.0–63.6

Moisture balance9.80 mm/mo -41.9–73.2

Vapour deficit1,224 Pa 669–1,371

Wind speed2.50 m/s 1.90–4.40

Cloud cover34.2 % 32.5–42.4

CHELSA 1981–2010, ~9 km grid, at location & month of 62 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)