Renia salusalis

Walker, 1859 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Renia

At a glance

Occurrence records578

Data sources7

Biological traits0

DNA specimens36

eDNA detections36

Sources7 archives

Databases and archives Renia salusalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility578 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF578 records

Environmental DNA1 datasets · 1 countries36 detections

DNA & barcodingBOLD36 specimens

01Narrative

Renia salusalis, the dotted renia, is a litter moth of the family Erebidae. The species was first described by Carl Linnaeus in his 1758 10th edition of Systema Naturae. It is found in the United States from Colorado, Ohio and Connecticut, south to Florida and Texas. The wingspan is about 27 mm. Adults are on wing from May to September in the north. There is at least a partial second generation in New Jersey. There are multiple generations in Missouri. The larvae feed on detritus, including dead leaves.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Renia salusalis has left across the world's sequence archives.

At a glance

DNA specimens36

BINs2

Marker genes1

eDNA detections36

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

16Tvariable

20Gmostly conserved

22Amostly conserved

46Tmostly conserved

70Tvariable

284Tmostly conserved

364Tmostly conserved

376Amostly conserved

391Cmostly conserved

406Cmostly conserved

451Tmostly conserved

457Tmostly conserved

520Amostly conserved

542Tmostly conserved

619Tmostly conserved

634Cvariable

646Cvariable

AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes9

BINs2

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Renia fraternalissame genus2.0%Renia factiosalissame genus4.9%Renia nemoralissame genus5.0%Renia discoloralissame genus5.3%Renia adspergillussame genus5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type578 records

Wild obs. + sensor449

Museum / vouchered129

Range

Area of Occupancy AOO1 560 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 216≤1 km 68≤10 km 35>10 km 33

352 georeferenced · 97 without coordinates

Open the mapobservation + sensor449

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤1 km 16≤10 km 53>10 km 14

83 georeferenced · 46 without coordinates

Open the institutions mapphysical evidence129

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	46
Mississippi State, US	22
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	11
Georgia Museum of Natural Historylocation not on record	8
Cambridge, US	7
East Lansing, US	5
St. Paul, US	3
OSUClocation not on record	1
Florida Museum of Natural History, McGuire Center for Lepidoptera and Biodiversitylocation not on record	1

9 institutions · 104 of 129 vouchered records shown · 25 without an institution code

09Environmental DNA36 detections

Where the DNA of Renia salusalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map1 country0

Oak ScrubOtherIndoorsFlatwoods/scrub

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.1 °C 16.8–25.7

Seasonal swing summer↔winter13.8 °C

Max temp (day)27.3 °C 21.6–30.2

Min temp (night)18.2 °C 11.9–22.2

Precipitation108 mm/mo 85.5–156

Air humidity58.9 % 57.4–63.6

Moisture balance-22.9 mm/mo -56.7–33.5

Vapour deficit1,051 Pa 805–1,201

Wind speed3.40 m/s 2.30–4.40

Cloud cover35.3 % 30.8–44.7

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)