Renia factiosalis

Walker, 1859 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Renia

At a glance

Occurrence records553

Data sources7

Biological traits0

DNA specimens80

eDNA detections77

Sources7 archives

Databases and archives Renia factiosalis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility553 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI77 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics80 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF553 records

Environmental DNA1 datasets · 2 countries77 detections

DNA & barcodingBOLD80 specimens

01Narrative

Renia factiosalis, the dark-banded renia or sociable renia moth, is a litter moth of the family Erebidae. The species was first described by Francis Walker in 1859. It is found from southern Canada to Florida and Texas. The wingspan is about 24 mm. Adults are on wing from May to September. There is one generation in the north-east, two generations in Missouri and multiple generations in the south. The larvae feed on organic matter, including dead leaves.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding80 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Renia factiosalis has left across the world's sequence archives.

At a glance

DNA specimens80

BINs3

Marker genes1

eDNA detections77

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus79 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

127Tmostly conserved

154Cmostly conserved

184Tmostly conserved

287Tmostly conserved

298Cmostly conserved

304Tmostly conserved

340Cmostly conserved

364Cmostly conserved

460Tmostly conserved

490Tmostly conserved

508Cmostly conserved

613Tmostly conserved

616Tmostly conserved

619Tmostly conserved

631Amostly conserved

641Tmostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTACTAATTCGAGCAGAATTAGGTAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes14

BINs3

Most divergent pair6.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Renia nemoralissame genus3.5%Renia flavipunctalissame genus3.8%Renia fraternalissame genus3.8%Renia sobrialissame genus3.8%Renia pulverosalissame genus3.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type553 records

Wild obs. + sensor405

Museum / vouchered148

Range

Area of Occupancy AOO1 208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 229≤1 km 80≤10 km 26>10 km 15

350 georeferenced · 55 without coordinates

Open the mapobservation + sensor405

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 5≤1 km 15≤10 km 40>10 km 6

66 georeferenced · 82 without coordinates

Open the institutions mapphysical evidence148

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	29
ASUlocation not on record	11
St. Paul, US	11
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8
Philadelphia, US	7
Cambridge, US	5
Cleveland Museum of Natural History, OH (CLEV)location not on record	5
New Haven, US	3
University of Alberta Museums (UAM)location not on record	3
Colorado State Universitylocation not on record	3
UDlocation not on record	3
Decorah, US	1
CUlocation not on record	1
Mississippi State, US	1
University of Alabamalocation not on record	1
Cornell University Insect Collectionlocation not on record	1

16 institutions · 93 of 148 vouchered records shown · 55 without an institution code

09Environmental DNA77 detections

Where the DNA of Renia factiosalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found77

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 77 detections have coordinates

Open the map2 countries0

Forest1. Forest & WoodlandTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 20.0–23.7

Seasonal swing summer↔winter26.6 °C

Max temp (day)25.3 °C 23.7–28.9

Min temp (night)17.5 °C 15.8–19.8

Precipitation106 mm/mo 84.1–128

Air humidity59.9 % 58.1–63.8

Moisture balance-48.7 mm/mo -76.0–-2.70

Vapour deficit1,022 Pa 881–1,183

Wind speed2.80 m/s 1.80–4.80

Cloud cover38.4 % 27.5–51.5

CHELSA 1981–2010, ~9 km grid, at location & month of 76 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)