Renia sobrialis

Walker, 1859 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Renia

At a glance

Occurrence records357

Data sources7

Biological traits0

DNA specimens52

eDNA detections52

Sources7 archives

Databases and archives Renia sobrialis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility357 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI52 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics52 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF357 records

Environmental DNA1 datasets · 2 countries52 detections

DNA & barcodingBOLD52 specimens

01Narrative

Renia sobrialis, the sober renia, is a litter moth of the family Erebidae. The species was first described by Francis Walker in 1859. It is found from Nova Scotia to Florida, west to Mississippi and Minnesota. The wingspan is 24–27 mm. Adults are on wing from April to September. The larvae feed on dead leaves.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding52 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Renia sobrialis has left across the world's sequence archives.

At a glance

DNA specimens52

BINs2

Marker genes1

eDNA detections52

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus52 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

20Gmostly conserved

22Amostly conserved

64Cvariable

97Tvariable

193Cvariable

199Cvariable

220Tvariable

247Tvariable

259Tvariable

268Tvariable

283Tvariable

304Cvariable

313Cvariable

367Cvariable

373Gvariable

379Avariable

460Tvariable

506Gmostly conserved

548Cvariable

556Tvariable

562Avariable

AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGACTATTAATCCGAGCTGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes6

BINs2

Most divergent pair2.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Renia factiosalissame genus3.8%Renia hutsonisame genus4.0%Renia flavipunctalissame genus4.3%Renia nemoralissame genus4.4%Renia pulverosalissame genus4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type357 records

Wild obs. + sensor176

Museum / vouchered181

Range

Area of Occupancy AOO784 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 86≤1 km 20≤10 km 9>10 km 9

124 georeferenced · 52 without coordinates

Open the mapobservation + sensor176

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤100 m 3≤1 km 5≤10 km 59>10 km 10

77 georeferenced · 104 without coordinates

Open the institutions mapphysical evidence181

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	50
Cleveland Museum of Natural History, OH (CLEV)location not on record	17
Cambridge, US	14
Mississippi State, US	11
St. Paul, US	10
Colorado State Universitylocation not on record	9
University of Alberta Museums (UAM)location not on record	6
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
CUlocation not on record	3
Cornell University Insect Collectionlocation not on record	3
Decorah, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Toronto, CA	1
University of California, Davislocation not on record	1
SOVTlocation not on record	1

15 institutions · 133 of 181 vouchered records shown · 48 without an institution code

09Environmental DNA52 detections

Where the DNA of Renia sobrialis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found52

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 52 detections have coordinates

Open the map2 countries0

Temperate mixed forestMixed Habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 18.1–25.0

Seasonal swing summer↔winter28.3 °C

Max temp (day)24.5 °C 22.6–27.2

Min temp (night)15.7 °C 15.2–24.2

Precipitation125 mm/mo 105–156

Air humidity60.1 % 58.0–64.5

Moisture balance-9.50 mm/mo

Vapour deficit938 Pa 766–1,146

Wind speed2.80 m/s

Cloud cover45.1 % 33.2–48.8

CHELSA 1981–2010, ~9 km grid, at location & month of 50 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)