Renia flavipunctalis

Geyer, 1832 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Renia

At a glance

Occurrence records2 300

Data sources7

Biological traits0

DNA specimens71

eDNA detections69

Sources7 archives

Databases and archives Renia flavipunctalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 300 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI69 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics71 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 300 records

Environmental DNA1 datasets · 2 countries69 detections

DNA & barcodingBOLD71 specimens

01Narrative

Renia flavipunctalis, the yellow-dotted renia, yellow-spotted renia or even-lined renia, is a litter moth of the family Erebidae. The species was first described by Carl Geyer in 1832. It is found from southern Canada (from Nova Scotia west to Alberta) to Florida and Texas. The wingspan is 26–31 mm. Adults are on wing from June to August. There is one generation in the north-east. The larvae feed on organic matter, including dead leaves of deciduous trees.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding71 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Renia flavipunctalis has left across the world's sequence archives.

At a glance

DNA specimens71

BINs2

Marker genes1

eDNA detections69

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus66 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

61Amostly conserved

67Amostly conserved

154Tmostly conserved

178Tmostly conserved

241Amostly conserved

247Tmostly conserved

274Amostly conserved

304Tmostly conserved

401Cvariable

460Tmostly conserved

536Cmostly conserved

562Amostly conserved

577Avariable

613Cvariable

622Cmostly conserved

646Tmostly conserved

658Cmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTACTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes21

BINs2

Most divergent pair9.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Renia pulverosalissame genus3.0%Renia hutsonisame genus3.5%Renia factiosalissame genus3.8%Renia discoloralissame genus4.3%Renia sobrialissame genus4.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 300 records

Wild obs. + sensor1 917

Museum / vouchered383

Range

Area of Occupancy AOO4 976 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 977≤1 km 311≤10 km 116>10 km 164

1 568 georeferenced · 349 without coordinates

Open the mapobservation + sensor1 917

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 3≤1 km 32≤10 km 102>10 km 25

162 georeferenced · 221 without coordinates

Open the institutions mapphysical evidence383

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
St. Paul, US	74
New Haven, US	71
Cambridge, US	43
Mississippi State, US	19
University of Guelph, Centre for Biodiversity Genomicslocation not on record	15
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	13
Royal Saskatchewan Museumlocation not on record	13
Cornell University Insect Collectionlocation not on record	13
East Lansing, US	13
University of Alberta Museums (UAM)location not on record	10
Cleveland Museum of Natural History, OH (CLEV)location not on record	9
Colorado State Universitylocation not on record	9
King Saud Universitylocation not on record	4
UDlocation not on record	3
Chicago, US	3
CUlocation not on record	2
Philadelphia, US	2
SOVTlocation not on record	2
University of Guelphlocation not on record	1
Toronto, CA	1
University of California, Davislocation not on record	1

21 institutions · 321 of 383 vouchered records shown · 62 without an institution code

09Environmental DNA69 detections

Where the DNA of Renia flavipunctalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found69

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 69 detections have coordinates

Open the map2 countries0

ForestUrban1. Forest & WoodlandTemperate mixed forestMixed Habitat1. Forest & Woodland|1.1 Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.4 °C 15.6–24.1

Seasonal swing summer↔winter30.5 °C

Max temp (day)25.5 °C 21.6–29.2

Min temp (night)16.2 °C 11.9–19.5

Precipitation98.1 mm/mo 74.3–123

Air humidity58.7 % 57.4–60.2

Moisture balance-48.1 mm/mo -75.9–-18.6

Vapour deficit1,011 Pa 728–1,227

Wind speed3.10 m/s 2.40–3.80

Cloud cover40.2 % 34.4–51.5

CHELSA 1981–2010, ~9 km grid, at location & month of 67 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Renia flavipunctalis

At a glance

Sources7 archives

At a glance

Record type2 300 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 300 records