Argyresthia arceuthina

Zeller, 1839 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Argyresthiidae/Argyresthia

At a glance

Occurrence records937

Data sources7

Biological traits2

DNA specimens16

eDNA detections72

Sources7 archives

Databases and archives Argyresthia arceuthina's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility937 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI72 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF937 records

Environmental DNA3 datasets · 7 countries72 detections

DNA & barcodingBOLD16 specimens

01Narrative

Argyresthia arceuthina is a moth of the family Yponomeutidae. It is found in Europe. The wingspan is 8–9 mm. The head and thorax are white, patagia bronzy. Forewings are bright shining golden-bronzy.The head is white. Forewings are fuscous, with purple reflections, base ochreous ; a thick white dorsal streak to tornus ; a darker fuscous median fascia, interrupted in disc, edged with whitish on costa ; some whitish costal strigulae posteriorly. Hindwings are pale grey.Meyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and description Adults are on wing from April to June depending on the location. The larvae feed on Juniperus species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyresthia arceuthina has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections72

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.09%

Haplotypes1

BIN1

Where individuals differ — all 3 variable positions, in barcode order

618Cmostly conserved

649Amostly conserved

650Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGTAATCCCGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyresthia trifasciatasame genus2.3%Argyresthia quadristrigellasame genus4.6%Argyresthia aurulentellasame genus4.7%Argyresthia pseudotsugasame genus4.9%Argyresthia laevigatellasame genus5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type937 records

Wild obs. + sensor728

Museum / vouchered209

Range

Area of Occupancy AOO1 904 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 337≤1 km 183≤10 km 159>10 km 1

680 georeferenced · 48 without coordinates

Open the mapobservation + sensor728

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy90% within 1 km

≤100 m 113≤1 km 38≤10 km 16

167 georeferenced · 42 without coordinates

Open the institutions mapphysical evidence209

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	53
SLU Artdatabankenlocation not on record	30
DanishLepidopterologicalSocietylocation not on record	22
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	16
Stockholm, SE	10
Tartu, EE	9
South Kensington, GB	6
Nijmegen, NL	5
Natural History Museum, Londonlocation not on record	4
Tilburg, NL	2
Helsinki, FI	1
Kuopio, FI	1
neflocation not on record	1

13 institutions · 160 of 209 vouchered records shown · 49 without an institution code

09Environmental DNA72 detections

Where the DNA of Argyresthia arceuthina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found72

Studies independent surveys3

Countries7

Verifiable raw sequence linked61

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 72 detections have coordinates

Open the map7 countries0

Farmland, coast and birch habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.0 °C 10.2–14.7

Seasonal swing summer↔winter18.3 °C

Max temp (day)17.8 °C 14.4–19.0

Min temp (night)10.3 °C 5.90–11.9

Precipitation61.1 mm/mo 42.2–85.1

Air humidity58.4 % 57.7–61.1

Moisture balance-48.4 mm/mo -86.5–-24.9

Vapour deficit641 Pa 508–698

Wind speed3.00 m/s 2.20–5.30

Cloud cover42.2 % 39.6–54.6

CHELSA 1981–2010, ~9 km grid, at location & month of 72 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)