Argyresthia pseudotsuga

Freeman, 1972 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Argyresthiidae/Argyresthia

At a glance

Occurrence records0

Data sources6

Biological traits0

DNA specimens10

eDNA detections11

Sources6 archives

Databases and archives Argyresthia pseudotsuga's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD10 specimens

01Narrative

Argyresthia pseudotsuga is a moth of the family Yponomeutidae. It is found in North America, including Washington. Adults emerge in April. The larvae feed on Pseudotsuga menziesii.HOSTS - a Database of the World's Lepidopteran Hostplants They mine the twigs and tips of their host plant. The larvae enter the twigs at a node mining in a spiral pattern around the new wood, or directly into the wood. They continue feeding until late fall when they move to the base of the twig and construct a pupal chamber. Pupation takes place around the end of January.A Guide to Insect Pests in Douglas-fir Seed Orchards

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyresthia pseudotsuga has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections11

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)0.69%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 20 variable positions, in barcode order

6Tmostly conserved

13Cmostly conserved

59Tmostly conserved

66Gmostly conserved

130Cmostly conserved

169Tmostly conserved

193Tmostly conserved

232Tmostly conserved

265Gmostly conserved

293Tmostly conserved

379Tmostly conserved

385Tmostly conserved

478Tmostly conserved

495Tmostly conserved

508Cmostly conserved

534Tmostly conserved

542Amostly conserved

565Cmostly conserved

592Tmostly conserved

622Amostly conserved

AACATTATATTTCATTTTTGGAATTTGATCTGGAATAGTAGGAACATCATTAAGATTGTTAATTCGAGCTGAATTAGGTAATCCAGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyresthia arceuthinasame genus4.9%Argyresthia aurulentellasame genus5.2%Argyresthia amiantellasame genus5.8%Argyresthia trifasciatasame genus5.8%Argyresthia columbiasame genus6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

09Environmental DNA11 detections

Where the DNA of Argyresthia pseudotsuga was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

5. Wetlands (inland)

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median4.80 °C 4.80–10.1

Seasonal swing summer↔winter13.4 °C

Max temp (day)7.40 °C 7.40–14.8

Min temp (night)2.00 °C 2.00–5.70

Precipitation272 mm/mo 97.8–272

Air humidity72.2 % 63.0–72.2

Moisture balance254 mm/mo 15.4–254

Vapour deficit238 Pa 238–464

Wind speed2.30 m/s 2.30–2.40

Cloud cover50.2 % 44.9–50.2

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)