Argyresthia trifasciata

Staudinger, 1871 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Argyresthiidae/Argyresthia

At a glance

Occurrence records3 314

Data sources7

Biological traits2

DNA specimens31

eDNA detections31

Sources7 archives

Databases and archives Argyresthia trifasciata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 314 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 314 records

Environmental DNA2 datasets · 8 countries31 detections

DNA & barcodingBOLD31 specimens

01Narrative

Argyresthia trifasciata, the juniper ermine moth, is a moth of the family Yponomeutidae. It is found in great parts of Europe,Fauna Europaea but originates from the Alps. The wingspan is 7–10 mm. The moth flies from May to September. . The larvae feed on Juniperus communis, Thuja, Chamaecyparis and Leylandcipres.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyresthia trifasciata has left across the world's sequence archives.

At a glance

DNA specimens31

BINs1

Marker genes1

eDNA detections31

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

238Gvariable

AACATTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyresthia arceuthinasame genus2.3%Argyresthia aurulentellasame genus5.3%Argyresthia pseudotsugasame genus5.8%Argyresthia quadristrigellasame genus5.9%Argyresthia amiantellasame genus6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 314 records

Wild obs. + sensor3 099

Museum / vouchered211

Other4

Origin

Native4

Range

Area of Occupancy AOO4 148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy45% within 1 km

≤100 m 1 114≤1 km 164≤10 km 1 581>10 km 12

2 871 georeferenced · 228 without coordinates

Open the mapobservation + sensor3 099

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 101≤1 km 11≤10 km 7

119 georeferenced · 92 without coordinates

Open the institutions mapphysical evidence211

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	91
Nijmegen, NL	37
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	30
NHMOlocation not on record	20
Tilburg, NL	9
ZSMlocation not on record	3
South Kensington, GB	3
Tartu, EE	2
Provincia di Livornolocation not on record	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Stockholm, SE	1
Natural History Museum, Londonlocation not on record	1
SLU Artdatabankenlocation not on record	1
Research Collection of Kai Berggrenlocation not on record	1

14 institutions · 202 of 211 vouchered records shown · 9 without an institution code

09Environmental DNA31 detections

Where the DNA of Argyresthia trifasciata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found31

Studies independent surveys2

Countries8

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 31 detections have coordinates

Open the map8 countries0

UrbanGarden centre

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.1 °C 5.40–16.2

Seasonal swing summer↔winter19.2 °C

Max temp (day)16.4 °C 8.10–20.4

Min temp (night)8.50 °C 1.60–11.2

Precipitation76.5 mm/mo 58.6–97.1

Air humidity60.2 % 56.9–63.0

Moisture balance-40.7 mm/mo -46.9–42.6

Vapour deficit610 Pa 389–791

Wind speed3.00 m/s 1.90–3.80

Cloud cover38.5 % 34.7–47.3

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argyresthia trifasciata

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type3 314 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 314 records