Argyresthia quadristrigella

Zeller, 1873 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Argyresthiidae/Argyresthia

At a glance

Occurrence records77

Data sources7

Biological traits0

DNA specimens12

eDNA detections7

Sources7 archives

Databases and archives Argyresthia quadristrigella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility77 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF77 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD12 specimens

01Narrative

Argyresthia quadristrigella is a moth of the family Yponomeutidae. It is found in North America, including Ohio, Oklahomamothphotographersgroup and Texas. The wingspan is about 10 mm. The forewings are golden white with the base, tip, and four nearly straight edged transverse fascia dark golden yellow. The hindwings are light gray.Revision Of The American Moths Of The Genus Argyresthia The larvae feed on Juniperus virginiana.HOSTS - a Database of the World's Lepidopteran Hostplants

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyresthia quadristrigella has left across the world's sequence archives.

At a glance

DNA specimens12

BINs2

Marker genes1

eDNA detections7

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.2%

Haplotypes2

BINs2

Most divergent pair1.8%

Where individuals differ — all 21 variable positions, in barcode order

85Tmostly conserved

92Tmostly conserved

169Amostly conserved

187Tmostly conserved

206Tmostly conserved

208Gmostly conserved

364Cvariable

373Tvariable

379Amostly conserved

400Amostly conserved

421Tmostly conserved

433Tmostly conserved

437Amostly conserved

500Tmostly conserved

556Amostly conserved

562Amostly conserved

574Tmostly conserved

631Amostly conserved

634Cmostly conserved

637Tmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGCTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyresthia arceuthinasame genus4.6%Argyresthia aurulentellasame genus5.6%Argyresthia trifasciatasame genus5.9%Argyresthia pseudotsugasame genus6.2%Argyresthia columbiasame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type77 records

Wild obs. + sensor62

Museum / vouchered15

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 19≤1 km 15≤10 km 1>10 km 4

39 georeferenced · 23 without coordinates

Open the mapobservation + sensor62

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Cambridge, US	1
University of Alberta Museums (UAM)location not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
East Lansing, US	1

6 institutions · 9 of 15 vouchered records shown · 5 without an institution code

09Environmental DNA7 detections

Where the DNA of Argyresthia quadristrigella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

4. Native Grassland5. Wetlands (inland)

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.9 °C 11.6–19.4

Seasonal swing summer↔winter24.9 °C

Max temp (day)24.4 °C 15.3–26.2

Min temp (night)11.2 °C 7.20–13.3

Precipitation35.4 mm/mo 25.8–35.5

Air humidity52.2 % 51.1–56.3

Moisture balance-102 mm/mo -111–-85.2

Vapour deficit985 Pa 677–1,108

Wind speed2.60 m/s 2.60–3.50

Cloud cover38.6 % 34.1–39.8

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)