Argyresthia aurulentella

Stainton, 1849 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Argyresthiidae/Argyresthia

At a glance

Occurrence records1 818

Data sources7

Biological traits2

DNA specimens29

eDNA detections188

Sources7 archives

Databases and archives Argyresthia aurulentella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 818 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI188 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 818 records

Environmental DNA3 datasets · 10 countries188 detections

DNA & barcodingBOLD29 specimens

01Narrative

Argyresthia aurulentella is a moth of the family Yponomeutidae. It is found in Northern Europe, Central Europe, western Russia and Macedonia.Fauna Europaea The wingspan is 7–9 mm. The moth flies from July to August.. The larvae feed on Juniperus communis.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)does not feed

Feeding guild (larval)herbivore

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyresthia aurulentella has left across the world's sequence archives.

At a glance

DNA specimens29

BINs2

Marker genes1

eDNA detections188

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.59%

Haplotypes2

BINs2

Most divergent pair0.15%

Where individuals differ — all 14 variable positions, in barcode order

216Gmostly conserved

530Gvariable

547Amostly conserved

548Tmostly conserved

550Amostly conserved

556Tmostly conserved

604Tmostly conserved

607Tmostly conserved

616Tmostly conserved

622Tmostly conserved

628Amostly conserved

640Tmostly conserved

645Amostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGATCTGGATTAGTAGGAACATCATTAAGATTATTAATTCGAGCAGAATTAGGTAACCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyresthia arceuthinasame genus4.7%Argyresthia pseudotsugasame genus5.2%Argyresthia columbiasame genus5.3%Argyresthia trifasciatasame genus5.3%Argyresthia quadristrigellasame genus5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 818 records

Wild obs. + sensor1 188

Museum / vouchered612

Other18

Range

Area of Occupancy AOO2 932 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 623≤1 km 207≤10 km 307>10 km 2

1 139 georeferenced · 49 without coordinates

Open the mapobservation + sensor1 188

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 247≤1 km 181≤10 km 44>10 km 56

528 georeferenced · 84 without coordinates

Open the institutions mapphysical evidence612

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Oulu, FI	144
NHMOlocation not on record	65
Kuopio, FI	47
Tartu, EE	32
SLU Artdatabankenlocation not on record	30
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	27
Provincia di Livornolocation not on record	24
Stockholm, SE	23
Rovaniemi, FI	6
ZMAAlocation not on record	6
Metsähallituslocation not on record	4
European Distributed Institute of Taxonomy (EDIT)location not on record	2
DABUHlocation not on record	2
neflocation not on record	2
Research Collection of Peter Lichtmanneckerlocation not on record	2
DanishLepidopterologicalSocietylocation not on record	2
NTNU-VMlocation not on record	1
RMZlocation not on record	1
Salzburg, AT	1
Philadelphia, US	1

20 institutions · 422 of 612 vouchered records shown · 190 without an institution code

09Environmental DNA188 detections

Where the DNA of Argyresthia aurulentella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found188

Studies independent surveys3

Countries10

Verifiable raw sequence linked145

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 188 detections have coordinates

Open the map10 countries0

Hay meadowFen edgeForest edge (suburban)

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.7 °C 12.5–16.0

Seasonal swing summer↔winter22.5 °C

Max temp (day)17.2 °C 15.4–19.8

Min temp (night)10.2 °C 8.80–12.5

Precipitation95.4 mm/mo 76.1–112

Air humidity61.3 % 59.0–62.1

Moisture balance22.3 mm/mo -23.7–37.6

Vapour deficit617 Pa 558–749

Wind speed2.70 m/s 1.80–3.20

Cloud cover50.0 % 43.5–55.1

CHELSA 1981–2010, ~9 km grid, at location & month of 187 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argyresthia aurulentella

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type1 818 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 818 records