Argyresthia laevigatella

Herrich-Schäffer, 1855 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Argyresthiidae/Argyresthia

At a glance

Occurrence records312

Data sources7

Biological traits2

DNA specimens23

eDNA detections26

Sources7 archives

Databases and archives Argyresthia laevigatella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility312 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF312 records

Environmental DNA1 datasets · 7 countries26 detections

DNA & barcodingBOLD23 specimens

01Narrative

Argyresthia laevigatella is a moth of the family Yponomeutidae. It is found in EuropeFauna Europaea and Japan. The wingspan is 9–13 mm. It is very similar to Argyresthia glabratella.Certain identification requires dissection of the genitalia. The moths are on wing from May to July depending on the location. The larvae feed on Larix decidua.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyresthia laevigatella has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections26

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

24Tmostly conserved

34Cmostly conserved

79Gmostly conserved

160Gmostly conserved

214Amostly conserved

346Amostly conserved

367Cmostly conserved

403Gvariable

625Gmostly conserved

628Amostly conserved

AACATTATATTTTATTTTTGGAATTTGATCTGGCATAGTAGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGGAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.53%

Haplotypes9

BIN1

Most divergent pair1.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyresthia arceuthinasame genus5.2%Argyresthia amiantellasame genus5.8%Argyresthia aurulentellasame genus5.9%Argyresthia columbiasame genus6.1%Argyresthia abiessame genus6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type312 records

Wild obs. + sensor213

Museum / vouchered82

Other17

Range

Area of Occupancy AOO912 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 39≤1 km 43≤10 km 124>10 km 1

207 georeferenced · 6 without coordinates

Open the mapobservation + sensor213

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 13≤1 km 22≤10 km 20>10 km 2

57 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence82

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Oulu, FI	19
Tartu, EE	18
DanishLepidopterologicalSocietylocation not on record	10
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	6
NHMOlocation not on record	4
Stockholm, SE	2
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	2
South Kensington, GB	2
SLU Artdatabankenlocation not on record	2
Rovaniemi, FI	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1
RMZlocation not on record	1
Salzburg, AT	1
ZSMlocation not on record	1
Research Collection of Kai Berggrenlocation not on record	1
Research Collection of Peter Lichtmanneckerlocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1

17 institutions · 73 of 82 vouchered records shown · 9 without an institution code

09Environmental DNA26 detections

Where the DNA of Argyresthia laevigatella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.6 °C 4.50–16.4

Seasonal swing summer↔winter20.4 °C

Max temp (day)16.1 °C 8.80–20.5

Min temp (night)5.40 °C -0.2–12.6

Precipitation103 mm/mo 69.5–223

Air humidity60.3 % 58.4–69.4

Moisture balance-2.80 mm/mo -42.6–107

Vapour deficit553 Pa 337–780

Wind speed3.10 m/s 1.20–6.10

Cloud cover37.8 % 32.1–51.0

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)