Argyresthia annettella

Busck, 1907 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Argyresthiidae/Argyresthia

At a glance

Occurrence records81

Data sources7

Biological traits0

DNA specimens44

eDNA detections45

Sources7 archives

Databases and archives Argyresthia annettella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility81 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics44 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF81 records

Environmental DNA1 datasets · 2 countries45 detections

DNA & barcodingBOLD44 specimens

01Narrative

Argyresthia annettella is a moth of the family Yponomeutidae. It is found in North America, including Ohio, Ontario and Quebec.mothphotographersgroup The wingspan is about 9 mm. The forewings are silvery white with a pale golden crooked fascia from the base of the costa to the basal third of the dorsal edge. There is a broad golden fascia on the middle of the wing. There is also an irregular inwardly curved golden fascia slightly furcate at the costal edge and at the apical third. This is preceded by a golden costal streak. The hindwings are light golden fuscous.Revision Of The American Moths Of The Genus Argyresthia The larvae feed on Juniperus communis. They mine the leaves of their host plant. The larvae are green. Pupation takes in an open-mesh cocoon outside the mine on the foliage.Caterpillars On The Foliage Of Conifers In The Northeastern United States

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding44 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyresthia annettella has left across the world's sequence archives.

At a glance

DNA specimens44

BINs2

Marker genes1

eDNA detections45

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P633 bp consensus41 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

69Tmostly conserved

156Amostly conserved

267Gmostly conserved

271Amostly conserved

540Gmostly conserved

606Tmostly conserved

609Amostly conserved

TTTATTTTTGGAATTTGATCAGGAATAGTTGGAACATCTTTAAGACTTCTAATTCGAGCTGAATTGGGTAATCCTGGATCATTAATTGGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.31%

Haplotypes5

BIN1

Most divergent pair0.63%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyresthia arceuthinasame genus6.8%Argyresthia trifasciatasame genus7.4%Argyresthia quadristrigellasame genus8.1%Argyresthia aurulentellasame genus8.2%Argyresthia laevigatellasame genus8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type81 records

Wild obs. + sensor13

Museum / vouchered68

Range

Area of Occupancy AOO88 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 11≤1 km 2

13 georeferenced

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 67 without coordinates

Open the institutions mapphysical evidence68

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	28
Washington, US	4
San Francisco, US	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

4 institutions · 34 of 68 vouchered records shown · 34 without an institution code

09Environmental DNA45 detections

Where the DNA of Argyresthia annettella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found45

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 45 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.1. Boreal Forest4. Native GrasslandMixed habitatWetlandForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 13.5–16.4

Seasonal swing summer↔winter24.8 °C

Max temp (day)19.2 °C 16.4–22.4

Min temp (night)12.1 °C 7.20–15.0

Precipitation105 mm/mo 89.0–126

Air humidity63.6 % 55.6–74.6

Moisture balance7.60 mm/mo

Vapour deficit659 Pa 448–875

Wind speed2.60 m/s

Cloud cover42.8 % 35.4–54.8

CHELSA 1981–2010, ~9 km grid, at location & month of 41 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)