Apristurus profundorum

(Goode & Bean, 1896) · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Carcharhiniformes/Scyliorhinidae/Apristurus

At a glance

Occurrence records533

Data sources10

Biological traits7

DNA specimens22

eDNA detections25

Sources10 archives

Databases and archives Apristurus profundorum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility117 records↗

OBISOcean Biodiversity Information System416 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS533 records

Environmental DNA3 datasets · 3 countries25 detections

DNA & barcodingBOLD22 specimens

01Narrative

The deepwater catshark (Apristurus profundorum) is a catshark of the family Scyliorhinidae, found in the western Atlantic from Delaware Bay to Suriname, and in the eastern Atlantic from Morocco to northwest Africa. An important key factor to understanding these creatures is ageing, many deepwater Apristurus profundorum have poorly calcified vertebrae that lack visible growth bands, and most do not have dorsal fin spines that can be used for ageing. Other methods, such as captive growth and tag-recapture, are also limited in their suitability for deepwater chondrichthyans due to difficulties in the deep sea.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length54.2 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebathydemersal

Uses & economy1

Commercial importanceof no interest

Other traits3

Depth max1 830 m

Depth min256 m

Vulnerability41.68

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apristurus profundorum has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes1

eDNA detections25

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

99Cmostly conserved

ACCCTATACTTAATTTTTGGTGCATGAGCAGGCATGGTTGGAATAGCCTTAAGTTTATTAATCCGTGCGGAGCTGGGTCAACCCGGATCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.04%

Haplotypes3

BIN1

Most divergent pair0.30%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apristurus pinguissame genus2.0%Apristurus amplicepssame genus3.4%Apristurus manissame genus3.4%Apristurus aphyodessame genus7.4%Apristurus kampaesame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type533 records

Wild obs. + sensor392

Museum / vouchered129

Other12

Range

Area of Occupancy AOO1 516 km²

Depth

0–200 m sunlit4

200–1000 m twilight47

1–4 km midnight313

>4 km abyssal0

median 1 251.8 m · max 2 652 m · 364 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 390 without coordinates

Open the mapobservation + sensor392

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 6≤10 km 4>10 km 8

18 georeferenced · 111 without coordinates

Open the institutions mapphysical evidence129

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
FishBaselocation not on record	15
Zoologisches Museum Hamburglocation not on record	11
Cambridge, US	9
Wuzhou, CN	4
Bergen, NO	4
New Haven, US	3
50location not on record	3
The Atlantic reference Centrelocation not on record	2
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	2
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
ICM-CSIClocation not on record	1
Washington, US	1
Toronto, CA	1
Brussels, BE	1

14 institutions · 58 of 129 vouchered records shown · 20 without an institution code

09Environmental DNA25 detections

Where the DNA of Apristurus profundorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys3

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map3 countries0

Pacific OceanAtlantic Ocean

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 10.4–14.3

Seasonal swing summer↔winter12.6 °C

Max temp (day)13.8 °C 11.2–15.3

Min temp (night)12.1 °C 9.70–13.4

Precipitation114 mm/mo 106–125

Air humidity76.2 % 66.9–78.9

Vapour deficit354 Pa 270–408

Cloud cover58.3 % 56.5–67.0

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)