Apristurus pinguis

Deng, Xiong & Zhan, 1983 · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Carcharhiniformes/Scyliorhinidae/Apristurus

At a glance

Occurrence records211

Data sources9

Biological traits6

DNA specimens19

eDNA detections14

Sources9 archives

Databases and archives Apristurus pinguis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility146 records↗

OBISOcean Biodiversity Information System65 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS211 records

Environmental DNA1 datasets · 2 countries14 detections

DNA & barcodingBOLD19 specimens

01Narrative

The bulldog catshark (Apristurus pinguis) is a catshark of the family Scyliorhinidae, found in the deep waters of the East China Sea and in the Northwest Pacific. In New Zealand waters it is found at the Reinga Ridge, the West Norfolk Ridge, the Hikurangi Trough and the Chatham Rise as well as on the Campbell Plateau.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length83.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebathypelagic

Other traits3

Depth max1 000 m

Depth min200 m

Vulnerability53.4

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apristurus pinguis has left across the world's sequence archives.

At a glance

DNA specimens19

BINs2

Marker genes1

eDNA detections14

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Diversity (π)2.1%

Haplotypes2

BINs2

Most divergent pair2.8%

Where individuals differ — all 42 variable positions, in barcode order

4Amostly conserved

45Cmostly conserved

46Cmostly conserved

55Gvariable

67Gmostly conserved

74Gmostly conserved

76Tmostly conserved

85Avariable

88Gmostly conserved

89Cmostly conserved

102Amostly conserved

112Tmostly conserved

127Tmostly conserved

136Tmostly conserved

157Avariable

166Avariable

196Cmostly conserved

268Tmostly conserved

274Cvariable

289Gvariable

298Gmostly conserved

301Gvariable

310Amostly conserved

325Avariable

349Gmostly conserved

358Gmostly conserved

382Cvariable

383Tmostly conserved

385Avariable

496Cvariable

538Tmostly conserved

541Cvariable

575Tmostly conserved

580Cmostly conserved

586Cmostly conserved

589Amostly conserved

598Cvariable

604Tvariable

628Gvariable

637Cvariable

643Cvariable

652Avariable

CCTATACCTAATTTTTGGTGCATGAGCAGGCATGGTTGGAATAGCCTTAAGTTTGTTAATCCGTGCGGAGCTGGGTCAACCCGGATCGCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apristurus profundorumsame genus2.0%Apristurus amplicepssame genus2.3%Apristurus manissame genus2.3%Apristurus aphyodessame genus6.7%Apristurus kampaesame genus7.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type211 records

Wild obs. + sensor50

Museum / vouchered161

Range

Area of Occupancy AOO240 km²

Depth

0–200 m sunlit0

200–1000 m twilight2

1–4 km midnight29

>4 km abyssal0

median 1 247.5 m · max 1 927 m · 31 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤1 km 38≤10 km 2>10 km 1

41 georeferenced · 9 without coordinates

Open the mapobservation + sensor50

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 12≤1 km 105≤10 km 15

132 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence161

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	102
Sydney, AU	6
CSIRO, Australian National Fish Collectionlocation not on record	4
Museum of New Zealand Te Papa Tongarewalocation not on record	3
FishBaselocation not on record	2
Museums Victorialocation not on record	2
Auckland, NZ	1

7 institutions · 120 of 161 vouchered records shown · 4 without an institution code

09Environmental DNA14 detections

Where the DNA of Apristurus pinguis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 11.5–18.9

Seasonal swing summer↔winter6.30 °C

Max temp (day)18.2 °C 12.2–19.8

Min temp (night)16.2 °C 10.6–18.1

Precipitation94.4 mm/mo 60.0–162

Air humidity60.2 % 59.3–61.3

Vapour deficit773 Pa 550–856

Cloud cover32.8 % 22.4–34.9

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)