Apristurus aphyodes

Nakaya & Stehmann, 1998 · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Carcharhiniformes/Scyliorhinidae/Apristurus

At a glance

Occurrence records614

Data sources9

Biological traits5

DNA specimens14

eDNA detections14

Sources9 archives

Databases and archives Apristurus aphyodes's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility171 records↗

OBISOcean Biodiversity Information System443 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS614 records

Environmental DNA1 datasets · 0 countries14 detections

DNA & barcodingBOLD14 specimens

01Narrative

The white ghost catshark (Apristurus aphyodes) is a shark of the catshark family Scyliorhinidae found in deep water in the northeast Atlantic between latitudes 57°N and 58°N. A deep-water catshark known from the eastern North Atlantic from depths of 1,014 to 1,800 m, it is known from only a limited number of specimens. It reaches a maximum of 54 cm or 1.7 ft total length which is a medium size for the Apristurus genus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebathypelagic

Other traits3

Depth max1 800 m

Depth min1 014 m

Vulnerability47.22

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apristurus aphyodes has left across the world's sequence archives.

At a glance

DNA specimens14

BINs2

Marker genes1

eDNA detections14

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P594 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

5Gmostly conserved

8Cmostly conserved

14Tmostly conserved

15Amostly conserved

17Gmostly conserved

19Cmostly conserved

21Gmostly conserved

24Gmostly conserved

30Tmostly conserved

37Gmostly conserved

38Gmostly conserved

46Cmostly conserved

47Amostly conserved

48Gmostly conserved

49Amostly conserved

50Tmostly conserved

58Gmostly conserved

59Tmostly conserved

522Cmostly conserved

564Tmostly conserved

ATTCGTGCGGAGTTAGGCCAGCCGGGGTCTCTTTTGGGTGATGACCAGATTTATAATGTAGTCGTAACTGCCCATGCCTTTGTAATAATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.52%

Haplotypes5

BINs2

Most divergent pair0.34%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apristurus kampaesame genus5.6%Apristurus pinguissame genus6.7%Apristurus manissame genus7.2%Apristurus profundorumsame genus7.4%Apristurus amplicepssame genus7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type614 records

Wild obs. + sensor92

Museum / vouchered155

Other367

Range

Area of Occupancy AOO468 km²

Depth

0–200 m sunlit0

200–1000 m twilight368

1–4 km midnight46

>4 km abyssal0

median 746 m · max 1 800 m · 414 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 42

42 georeferenced · 50 without coordinates

Open the mapobservation + sensor92

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 21≤1 km 1

22 georeferenced · 133 without coordinates

Open the institutions mapphysical evidence155

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	26
Zoologisches Museum Hamburglocation not on record	25
Paris, FR	25
FishBaselocation not on record	13
Bergen, NO	1
Washington, US	1

6 institutions · 91 of 155 vouchered records shown

09Environmental DNA14 detections

Where the DNA of Apristurus aphyodes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)