Apristurus manis

(Springer, 1979) · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Carcharhiniformes/Scyliorhinidae/Apristurus

At a glance

Occurrence records497

Data sources8

Biological traits7

DNA specimens13

eDNA detections0

Sources8 archives

Databases and archives Apristurus manis's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility211 records↗

OBISOcean Biodiversity Information System286 records↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS497 records

DNA & barcodingBOLD13 specimens

01Narrative

The ghost catshark (Apristurus manis) is a catshark of the family Scyliorhinidae found on the continental slopes in the northwest Atlantic off Massachusetts, the northeast Atlantic from the Porcupine Bank west of Ireland and the southern Atlantic off Cape Town, at depths between 600 and.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length85 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebathydemersal

Uses & economy1

Commercial importanceof no interest

Other traits3

Depth max1 900 m

Depth min600 m

Vulnerability54

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apristurus manis has left across the world's sequence archives.

At a glance

DNA specimens13

BINs3

Marker genes1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 83% of positions are identical in every specimen.

Where individuals differ — all 111 variable positions, in barcode order

4Amostly conserved

8Cmostly conserved

31Tmostly conserved

43Amostly conserved

46Cmostly conserved

52Tmostly conserved

61Cmostly conserved

67Gmostly conserved

70Gmostly conserved

73Gmostly conserved

76Tmostly conserved

85Gmostly conserved

88Gmostly conserved

91Cmostly conserved

97Tmostly conserved

103Cmostly conserved

112Tmostly conserved

118Amostly conserved

119Gmostly conserved

124Amostly conserved

127Tmostly conserved

136Tmostly conserved

157Gmostly conserved

160Tmostly conserved

163Amostly conserved

166Amostly conserved

178Cmostly conserved

181Cmostly conserved

187Amostly conserved

196Cmostly conserved

199Cmostly conserved

217Amostly conserved

229Amostly conserved

235Amostly conserved

238Amostly conserved

253Tmostly conserved

256Tmostly conserved

262Tmostly conserved

265Tmostly conserved

268Tmostly conserved

271Tmostly conserved

277Cmostly conserved

287Cmostly conserved

295Cmostly conserved

298Gmostly conserved

301Amostly conserved

304Amostly conserved

307Gmostly conserved

313Gmostly conserved

316Tmostly conserved

322Amostly conserved

325Gmostly conserved

331Gmostly conserved

340Amostly conserved

343Tmostly conserved

346Amostly conserved

349Gmostly conserved

352Cmostly conserved

356Cmostly conserved

367Cmostly conserved

370Gmostly conserved

379Amostly conserved

382Tmostly conserved

383Tmostly conserved

384Tmostly conserved

385Gmostly conserved

386Gmostly conserved

394Cmostly conserved

400Tmostly conserved

406Amostly conserved

409Tmostly conserved

413Amostly conserved

421Cmostly conserved

424Cmostly conserved

427Gmostly conserved

451Amostly conserved

469Amostly conserved

475Tmostly conserved

478Cmostly conserved

481Tmostly conserved

493Amostly conserved

497Tmostly conserved

499Gmostly conserved

508Amostly conserved

514Cmostly conserved

526Tmostly conserved

532Tmostly conserved

541Tmostly conserved

542Gmostly conserved

544Cmostly conserved

550Amostly conserved

575Tmostly conserved

577Gmostly conserved

580Cmostly conserved

589Amostly conserved

595Tmostly conserved

598Cmostly conserved

604Cmostly conserved

607Cmostly conserved

613Cmostly conserved

616Cmostly conserved

619Tmostly conserved

622Amostly conserved

630Amostly conserved

631Cmostly conserved

634Amostly conserved

636Tmostly conserved

637Cmostly conserved

640Tmostly conserved

643Cmostly conserved

652Gmostly conserved

CCTATACCTAATTTTTGGTGCATGAGCAGGTATGGTTGGAATAGCCTTAAGTTTATTAATCCGTGCGGAGCTGGGTCAACCCGGGTCGCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.2%

Haplotypes4

BINs3

Most divergent pair14.4%

OtherN.AmericaAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apristurus pinguissame genus2.3%Apristurus profundorumsame genus3.4%Apristurus aphyodessame genus7.2%Apristurus kampaesame genus7.5%Apristurus longicephalussame genus10.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type497 records

Wild obs. + sensor168

Museum / vouchered202

Other127

Range

Area of Occupancy AOO340 km²

Depth

0–200 m sunlit0

200–1000 m twilight168

1–4 km midnight20

>4 km abyssal0

median 753.6 m · max 1 915.5 m · 188 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 114

114 georeferenced · 54 without coordinates

Open the mapobservation + sensor168

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 3≤1 km 10≤10 km 4>10 km 24

41 georeferenced · 161 without coordinates

Open the institutions mapphysical evidence202

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	56
South Kensington, GB	11
Bergen, NO	10
50location not on record	8
Zoologisches Museum Hamburglocation not on record	7
Washington, US	5
New Haven, US	4
Wuzhou, CN	4
Paris, FR	3
FishBaselocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1

11 institutions · 110 of 202 vouchered records shown · 5 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)