Apristurus kampae

Taylor, 1972 · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Carcharhiniformes/Scyliorhinidae/Apristurus

At a glance

Occurrence records114

Data sources9

Biological traits6

DNA specimens6

eDNA detections5

Sources9 archives

Databases and archives Apristurus kampae's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility52 records↗

OBISOcean Biodiversity Information System62 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS114 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD6 specimens

01Narrative

The longnose catshark (Apristurus kampae) is a catshark of the family Scyliorhinidae found in the eastern central Pacific from central and southern California and the Gulf of California, between latitudes 38° N and 23° N, at depths down to 1,890. Its length is up to 58 cm.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length58.4 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebathydemersal

Uses & economy1

Commercial importancesubsistence fisheries

Other traits2

Depth max1 888 m

Vulnerability43.36

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apristurus kampae has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.15%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 2 variable positions, in barcode order

47Tmostly conserved

304Tvariable

CCTATACCTAATTTTTGGTGCATGAGCAGGTATGGTTGGAATGGCCTTAAGTTTATTAATTCGTGCGGAGTTGGGTCAACCTGGGTCTCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apristurus aphyodessame genus5.6%Apristurus amplicepssame genus7.2%Apristurus pinguissame genus7.5%Apristurus manissame genus7.5%Apristurus profundorumsame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type114 records

Wild obs. + sensor5

Museum / vouchered109

Origin

Native19

Range

Area of Occupancy AOO184 km²

Depth

0–200 m sunlit14

200–1000 m twilight9

1–4 km midnight11

>4 km abyssal0

median 470 m · max 1 859 m · 34 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 4 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 5≤1 km 2≤10 km 2>10 km 1

10 georeferenced · 99 without coordinates

Open the institutions mapphysical evidence109

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UWFClocation not on record	12
University of California San Diegolocation not on record	12
CASlocation not on record	8
Wuzhou, CN	4
Los Angeles, US	4
Barcelona, ES	3
FishBaselocation not on record	2
Zoologisches Museum Hamburglocation not on record	1
University of Washingtonlocation not on record	1

9 institutions · 47 of 109 vouchered records shown · 4 without an institution code

09Environmental DNA5 detections

Where the DNA of Apristurus kampae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)