Apristurus ampliceps

Sasahara, Sato & Nakaya, 2008 · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Carcharhiniformes/Scyliorhinidae/Apristurus

At a glance

Occurrence records191

Data sources9

Biological traits6

DNA specimens21

eDNA detections6

Sources9 archives

Databases and archives Apristurus ampliceps's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility114 records↗

OBISOcean Biodiversity Information System77 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS191 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD21 specimens

01Narrative

The roughskin catshark (Apristurus ampliceps) is a species of catshark in the family Scyliorhinidae found near Australia and New Zealand. Its natural habitat is the open seas. This species belongs to a genus of poorly known deep-water catsharks. This species was first described in 2008 by Ryohei Sasahara, Keiichi Sato & Kazuhiro Nakaya. Very little is known of its biology. This species is known to occur in deep water (840 to 1,380 m) off New Zealand, sporadic sites around Tasmania, and a small area of Western Australia. Some concern exists for this species, as its distribution includes some heavily fished areas. Deep-water demersal trawl fisheries are expanding in the region, and assuming its biology is like other deep-water shark species, it may not be sufficiently fecund to withstand the exploitation pressure.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length85.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebathydemersal

Other traits3

Depth max1 503 m

Depth min800 m

Vulnerability54.2

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apristurus ampliceps has left across the world's sequence archives.

At a glance

DNA specimens21

BINs2

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

8Cmostly conserved

31Cvariable

71Cmostly conserved

73Gmostly conserved

119Gmostly conserved

124Amostly conserved

127Tvariable

133Tmostly conserved

157Gvariable

177Gmostly conserved

260Cmostly conserved

262Tvariable

301Amostly conserved

373Cvariable

391Cvariable

433Amostly conserved

496Cmostly conserved

601Cvariable

628Avariable

637Tvariable

CCTATACCTAATTTTTGGTGCATGAGCAGGCATGGTTGGAATAGCCTTAAGTTTATTAATCCGTGCGGAGCTGGGTCAACCCGGGTCGCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.96%

Haplotypes3

BINs2

Most divergent pair1.5%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apristurus pinguissame genus2.3%Apristurus profundorumsame genus3.4%Apristurus kampaesame genus7.2%Apristurus aphyodessame genus7.6%Apristurus longicephalussame genus10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type191 records

Wild obs. + sensor14

Museum / vouchered177

Range

Area of Occupancy AOO176 km²

Depth

0–200 m sunlit0

200–1000 m twilight3

1–4 km midnight36

>4 km abyssal0

median 1 150 m · max 1 410 m · 39 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 2≤1 km 11≤10 km 1

14 georeferenced

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 33≤1 km 87≤10 km 8

128 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence177

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	86
CSIRO, Australian National Fish Collectionlocation not on record	4
Sydney, AU	3
Museums Victorialocation not on record	1

4 institutions · 94 of 177 vouchered records shown · 12 without an institution code

09Environmental DNA6 detections

Where the DNA of Apristurus ampliceps was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.7 °C 12.4–16.3

Seasonal swing summer↔winter4.40 °C

Max temp (day)15.6 °C 13.3–17.2

Min temp (night)13.7 °C 11.4–15.4

Precipitation67.5 mm/mo 31.2–73.2

Air humidity60.3 % 59.5–60.5

Vapour deficit660 Pa 582–733

Cloud cover22.0 % 18.7–35.5

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)