Anthidium montanum

Morawitz, 1865 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Anthidium

At a glance

Occurrence records472

Data sources6

Biological traits0

DNA specimens9

eDNA detections6

Sources6 archives

Databases and archives Anthidium montanum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility472 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF472 records

Environmental DNA1 datasets · 3 countries6 detections

DNA & barcodingBOLD9 specimens

01Narrative

Anthidium montanum is a species of bee in the family Megachilidae, the leaf-cutter, carder, or mason bees.2004, Apoidea Database, Fauna EuropaeaCatalogue of Life : 2009 Annual Checklist : Literature references

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthidium montanum has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections6

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

398Tmostly conserved

617Gmostly conserved

TATTATATATAATTTTTGCCCTATGAGCTGGAATAATTGGATCCTCAATAAGAATAATTATCCGAATAGAATTAAGTATTCCCGGATCAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.14%

Haplotypes3

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthidium tenuifloraesame genus9.3%Anthidium emarginatumsame genus9.5%Anthidium clypeodentatumsame genus9.6%Anthidium utahensesame genus9.6%Anthidium palmarumsame genus9.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type472 records

Wild obs. + sensor64

Museum / vouchered406

Other2

Origin

Native186

Range

Area of Occupancy AOO660 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy14% within 1 km

≤100 m 6≤1 km 2≤10 km 45>10 km 4

57 georeferenced · 7 without coordinates

Open the mapobservation + sensor64

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy2% within 1 km

≤100 m 1≤1 km 7≤10 km 349>10 km 25

382 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence406

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	76
Musee d'Histoire Naturallelocation not on record	47
Bern, CH	46
Dhaka, BD	23
PRUNlocation not on record	15
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	11
Museum zu Allerheiligen Schaffhausenlocation not on record	8
PRAZlocation not on record	8
Sion, CH	4
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	4
Paro, BT	4
Philadelphia, US	4
Geneva, CH	3
	3
Bavarian State Collection of Zoologylocation not on record	3
Universität Zürich, Naturhistorisches Museumlocation not on record	2
Provincia di Livornolocation not on record	2
Instituto Nacional de Saludlocation not on record	2
Wuzhou, CN	1
Beltsville, US	1
PINGlocation not on record	1
NMOKlocation not on record	1
ZHANGlocation not on record	1

23 institutions · 270 of 406 vouchered records shown · 136 without an institution code

09Environmental DNA6 detections

Where the DNA of Anthidium montanum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.1 °C 8.80–13.3

Seasonal swing summer↔winter20.9 °C

Max temp (day)14.9 °C 13.4–17.6

Min temp (night)3.50 °C 2.70–7.20

Precipitation158 mm/mo 105–235

Air humidity61.2 % 58.5–62.7

Moisture balance44.2 mm/mo -10.8–121

Vapour deficit481 Pa 428–638

Wind speed4.10 m/s 2.50–5.30

Cloud cover37.3 % 37.2–37.9

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)