Anthidium clypeodentatum

Swenk, 1914 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Anthidium

At a glance

Occurrence records230

Data sources7

Biological traits1

DNA specimens25

eDNA detections23

Sources7 archives

Databases and archives Anthidium clypeodentatum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility230 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF230 records

Environmental DNA1 datasets · 2 countries23 detections

DNA & barcodingBOLD25 specimens

01Narrative

Anthidium clypeodentatum is a species of bee in the family Megachilidae, the leaf-cutter, carder, or mason bees.Griswold, T., and J. S. Ascher., 2005, Checklist of Apoidea of North America (including Central America and the Caribbean)Catalogue of Life : 2009 Annual Checklist : Literature references

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.74 mm

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthidium clypeodentatum has left across the world's sequence archives.

At a glance

DNA specimens25

BINs1

Marker genes1

eDNA detections23

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

271Cmostly conserved

316Amostly conserved

364Tmostly conserved

451Avariable

589Cvariable

646Cvariable

TATATTATATATAATTTTTGCTATATGAGCTGGAATAATTGGTTCTTCAATAAGAATAATTATTCGAATAGAATTAAGAATTCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.47%

Haplotypes4

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthidium formosumsame genus8.2%Anthidium placitumsame genus8.5%Anthidium palmarumsame genus9.0%Anthidium montanumsame genus9.6%Anthidium florentinumsame genus9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type230 records

Wild obs. + sensor6

Museum / vouchered224

Range

Area of Occupancy AOO396 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤1 km 2≤10 km 3

5 georeferenced · 1 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 2≤1 km 27≤10 km 9>10 km 2

40 georeferenced · 184 without coordinates

Open the institutions mapphysical evidence224

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WIlocation not on record	104
Wuzhou, CN	33
Royal Saskatchewan Museumlocation not on record	31
Beltsville, US	10
	10
Weber State University, Bird and Mammal Collectionlocation not on record	7
Alberta Environment and Parkslocation not on record	5
Awka, NG	4
Champaign, US	4
San Diego, US	3
Sherwood Park, CA	2
University of Central Floridalocation not on record	2
Cambridge, US	1
Roberts Creek, CA	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
US	1
WSUClocation not on record	1
University of Manitoba, Wallis Roughley Museum of Entomologylocation not on record	1
University of Alabamalocation not on record	1

19 institutions · 222 of 224 vouchered records shown · 2 without an institution code

09Environmental DNA23 detections

Where the DNA of Anthidium clypeodentatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map2 countries0

Grassland4. Native GrasslandForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 14.2–19.5

Seasonal swing summer↔winter34.6 °C

Max temp (day)22.8 °C 18.5–25.4

Min temp (night)11.9 °C 7.50–14.9

Precipitation58.5 mm/mo 31.1–85.8

Air humidity55.0 % 50.3–58.2

Moisture balance-85.7 mm/mo -115–-53.9

Vapour deficit903 Pa 748–982

Wind speed3.00 m/s 2.10–4.50

Cloud cover38.5 % 34.5–41.0

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)