Anthidium palmarum

Cockerell, 1904 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Anthidium

At a glance

Occurrence records727

Data sources6

Biological traits1

DNA specimens75

eDNA detections50

Sources6 archives

Databases and archives Anthidium palmarum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility727 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI50 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics75 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF727 records

Environmental DNA1 datasets · 1 countries50 detections

DNA & barcodingBOLD75 specimens

01Narrative

Anthidium palmarum is a species of bee in the family Megachilidae, the leaf-cutter, carder, or mason bees.Griswold, T., and J. S. Ascher., 2005, Checklist of Apoidea of North America (including Central America and the Caribbean)Catalogue of Life : 2009 Annual Checklist : Literature references

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.75 mm

05DNA & barcoding75 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthidium palmarum has left across the world's sequence archives.

At a glance

DNA specimens75

BINs1

Marker genes1

eDNA detections50

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus73 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

235Cmostly conserved

542Cmostly conserved

631Gmostly conserved

634Cmostly conserved

AATATTATATATAATTTTTGCATTATGAGCTGGAATAATTGGATCTTCAATAAGAATAATTATTCGTATAGAATTAAGTATCCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.25%

Haplotypes16

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthidium placitumsame genus7.9%Anthidium atrifronssame genus7.9%Anthidium cingulatumsame genus8.1%Anthidium formosumsame genus8.2%Anthidium emarginatumsame genus8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type727 records

Wild obs. + sensor18

Museum / vouchered707

Other2

Range

Area of Occupancy AOO580 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 16≤10 km 1

17 georeferenced · 1 without coordinates

Open the mapobservation + sensor18

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤100 m 7≤1 km 13≤10 km 258>10 km 9

287 georeferenced · 420 without coordinates

Open the institutions mapphysical evidence707

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	255
Champaign, US	197
University of Alabamalocation not on record	155
	25
San Diego, US	15
Cambridge, US	14
Cornell University Insect Collectionlocation not on record	12
Beltsville, US	11
Ciudad de México, MX	7
Albuquerque, US	7
ASUlocation not on record	4
Mexico City, MX	2
EL PASO, US	1
Awka, NG	1
Royal Saskatchewan Museumlocation not on record	1

15 institutions · 707 of 707 vouchered records shown

09Environmental DNA50 detections

Where the DNA of Anthidium palmarum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found50

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 50 detections have coordinates

Open the map1 country0

sonoran desert

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.6 °C 16.0–21.3

Seasonal swing summer↔winter19.7 °C

Max temp (day)28.1 °C 23.2–28.6

Min temp (night)13.1 °C 9.00–14.0

Precipitation5.30 mm/mo 4.90–14.2

Air humidity43.1 % 39.2–45.0

Moisture balance-190 mm/mo -190–-141

Vapour deficit1,388 Pa 1,007–1,416

Wind speed4.40 m/s 3.20–4.50

Cloud cover29.2 % 28.5–35.2

CHELSA 1981–2010, ~9 km grid, at location & month of 50 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)