Anthidium emarginatum

(Say, 1824) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Anthidium

At a glance

Occurrence records263

Data sources7

Biological traits0

DNA specimens16

eDNA detections41

Sources7 archives

Databases and archives Anthidium emarginatum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility263 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI41 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF263 records

Environmental DNA1 datasets · 2 countries41 detections

DNA & barcodingBOLD16 specimens

01Narrative

Anthidium emarginatum is a species of bee in the family Megachilidae, the leaf-cutter, carder, or mason bees.Griswold, T., and J. S. Ascher., 2005, Checklist of Apoidea of North America (including Central America and the Caribbean)Catalogue of Life : 2009 Annual Checklist : Literature references

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthidium emarginatum has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections41

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)0.59%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 27 variable positions, in barcode order

2Amostly conserved

3Tmostly conserved

4Amostly conserved

5Cmostly conserved

6Tmostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

10Tmostly conserved

11Amostly conserved

12Tmostly conserved

13Amostly conserved

15Tmostly conserved

20Gmostly conserved

21Cmostly conserved

24Tmostly conserved

27Gmostly conserved

28Amostly conserved

29Gmostly conserved

30Cmostly conserved

31Amostly conserved

32Gmostly conserved

34Amostly conserved

181Amostly conserved

247Tmostly conserved

292Amostly conserved

406Cmostly conserved

CATACTATATATAATTTTTGCCCTTTGAGCAGGAATAATTGGATCTTCAATAAGAATAATTATTCGAATAGAATTAAGAACCCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthidium tenuifloraesame genus6.2%Anthidium atrifronssame genus6.8%Anthidium placitumsame genus7.6%Anthidium palmarumsame genus8.4%Anthidium utahensesame genus8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type263 records

Wild obs. + sensor2

Museum / vouchered261

Range

Area of Occupancy AOO416 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤100 m 2≤1 km 11≤10 km 139>10 km 3

155 georeferenced · 106 without coordinates

Open the institutions mapphysical evidence261

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	96
Colorado State Universitylocation not on record	43
University of Alabamalocation not on record	29
Albuquerque, US	26
Beltsville, US	19
Cambridge, US	13
Wuzhou, CN	13
Oregon State Arthropod Collectionlocation not on record	6
Chicago, US	4
Universidad Católica de Manizaleslocation not on record	3
Weber State University, Bird and Mammal Collectionlocation not on record	3
	2
University of California, Riverside, Entomology Research Museumlocation not on record	1
Awka, NG	1
UFPRlocation not on record	1
Severin-McDaniel Insect Collectionlocation not on record	1

16 institutions · 261 of 261 vouchered records shown

09Environmental DNA41 detections

Where the DNA of Anthidium emarginatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found41

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 41 detections have coordinates

Open the map2 countries0

4. Native Grassland | 4.4. Temperate Grassland1. Forest & Woodland | 1.4. Temperate Forest1. Forest & Woodland|1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 10.6–17.6

Seasonal swing summer↔winter22.6 °C

Max temp (day)22.1 °C 16.8–25.7

Min temp (night)7.10 °C 3.90–10.0

Precipitation18.5 mm/mo 10.4–44.4

Air humidity43.1 % 37.2–50.0

Moisture balance-137 mm/mo -192–-101

Vapour deficit926 Pa 742–1,144

Wind speed3.60 m/s 2.50–9.60

Cloud cover29.4 % 13.1–35.2

CHELSA 1981–2010, ~9 km grid, at location & month of 40 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)