Anthidium tenuiflorae

Cockerell, 1907 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Anthidium

At a glance

Occurrence records642

Data sources7

Biological traits1

DNA specimens33

eDNA detections42

Sources7 archives

Databases and archives Anthidium tenuiflorae's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility642 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI42 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF642 records

Environmental DNA1 datasets · 2 countries42 detections

DNA & barcodingBOLD33 specimens

01Narrative

Anthidium tenuiflorae is a species of bee in the family Megachilidae, the leaf-cutter, carder, or mason bees.Griswold, T., and J. S. Ascher., 2005, Checklist of Apoidea of North America (including Central America and the Caribbean)Catalogue of Life : 2009 Annual Checklist : Literature references

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.37 mm

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthidium tenuiflorae has left across the world's sequence archives.

At a glance

DNA specimens33

BINs1

Marker genes1

eDNA detections42

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

52Amostly conserved

130Amostly conserved

223Amostly conserved

373Tmostly conserved

433Amostly conserved

TATACTATATATAATTTTTGCTCTTTGAGCAGGTATAATTGGATCTTCAATAAGAATAATTATTCGAATAGAATTAAGAACCCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.18%

Haplotypes5

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthidium emarginatumsame genus6.2%Anthidium atrifronssame genus7.3%Anthidium placitumsame genus7.5%Anthidium formosumsame genus8.8%Anthidium palmarumsame genus9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type642 records

Wild obs. + sensor15

Museum / vouchered627

Range

Area of Occupancy AOO1 008 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 8≤10 km 3>10 km 1

12 georeferenced · 3 without coordinates

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 9≤1 km 11≤10 km 76>10 km 5

101 georeferenced · 526 without coordinates

Open the institutions mapphysical evidence627

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	185
Royal Saskatchewan Museumlocation not on record	90
Beltsville, US	55
Colorado State Universitylocation not on record	50
	44
US	36
Champaign, US	32
WIlocation not on record	29
Weber State University, Bird and Mammal Collectionlocation not on record	15
Alberta Environment and Parkslocation not on record	14
San Diego, US	10
Provo, US	9
Cambridge, US	8
Anchorage, US	8
Vancouver, CA	8
Oregon State Arthropod Collectionlocation not on record	6
Edmonton, CA	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
University of Central Floridalocation not on record	3
UFPRlocation not on record	2
UWMEDlocation not on record	1
University of Alaska Anchorage, Herbariumlocation not on record	1
ASUlocation not on record	1
University of California, Riverside, Entomology Research Museumlocation not on record	1
Sherwood Park, CA	1
Roberts Creek, CA	1
University of Alabamalocation not on record	1
Severin-McDaniel Insect Collectionlocation not on record	1
Chicago, US	1

29 institutions · 620 of 627 vouchered records shown · 7 without an institution code

09Environmental DNA42 detections

Where the DNA of Anthidium tenuiflorae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found42

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 42 detections have coordinates

Open the map2 countries0

Riparian Zone4. Native GrasslandAgriculture. Grass/Sedge, Forbs; Iris setosa…Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.6 °C 13.7–19.8

Seasonal swing summer↔winter26.9 °C

Max temp (day)23.5 °C 18.7–26.6

Min temp (night)10.5 °C 6.70–14.1

Precipitation44.6 mm/mo 13.8–78.6

Air humidity51.1 % 42.3–57.0

Moisture balance-95.6 mm/mo -161–-57.1

Vapour deficit954 Pa 707–1,201

Wind speed2.20 m/s 1.90–4.30

Cloud cover36.0 % 14.4–42.4

CHELSA 1981–2010, ~9 km grid, at location & month of 37 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)