Anthidium placitum

Cresson, 1879 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Anthidium

At a glance

Occurrence records327

Data sources6

Biological traits0

DNA specimens20

eDNA detections0

Sources6 archives

Databases and archives Anthidium placitum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility327 records↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF327 records

DNA & barcodingBOLD20 specimens

01Narrative

Anthidium placitum is a species of bee in the family Megachilidae, the leaf-cutter, carder, or mason bees.Griswold, T., and J. S. Ascher., 2005, Checklist of Apoidea of North America (including Central America and the Caribbean)Catalogue of Life : 2009 Annual Checklist : Literature references

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthidium placitum has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.16%

Haplotypes1

BIN1

Where individuals differ — all 5 variable positions, in barcode order

8Tmostly conserved

27Gmostly conserved

233Cmostly conserved

269Cmostly conserved

531Tmostly conserved

TATTATATATAATTTTTGCTTTATGAGCAGGTATAATTGGATCTTCAATAAGAATAATTATTCGAATAGAATTAAGTACCCCAGGATCAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthidium atrifronssame genus7.3%Anthidium utahensesame genus7.3%Anthidium tenuifloraesame genus7.5%Anthidium emarginatumsame genus7.6%Anthidium collectumsame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type327 records

Museum / vouchered327

Range

Area of Occupancy AOO372 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy2% within 1 km

≤100 m 1≤1 km 1≤10 km 100>10 km 2

104 georeferenced · 223 without coordinates

Open the institutions mapphysical evidence327

10Collections & institutions

Holding institutions11 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	132
San Diego, US	83
Wuzhou, CN	43
US	18
Colorado State Universitylocation not on record	14
Provo, US	10
Champaign, US	9
	5
Oregon State Arthropod Collectionlocation not on record	4
Cambridge, US	2
University of Central Floridalocation not on record	2
Awka, NG	1
University of California, Riverside, Entomology Research Museumlocation not on record	1
La Jolla, US	1
Chicago, US	1
University of Alabamalocation not on record	1

16 institutions · 327 of 327 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)