Anthidium collectum

Huard, 1896 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Anthidium

At a glance

Occurrence records527

Data sources7

Biological traits2

DNA specimens6

eDNA detections3

Sources7 archives

Databases and archives Anthidium collectum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility527 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF527 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD6 specimens

01Narrative

Anthidium collectum is a species of bee in the family Megachilidae, the leaf-cutter, carder, or mason bees.Griswold, T., and J. S. Ascher., 2005, Checklist of Apoidea of North America (including Central America and the Caribbean)Catalogue of Life : 2009 Annual Checklist : Literature references

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology2

Intertegular distance (ITD)2.72 mm

Tongue length4.89 mm

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthidium collectum has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

385Cvariable

CATATTATATATAATTTTTGCTTTATGGGCAGGTATAATTGGATCTTCAATAAGAATAATTATCCGAATAGAATTAAGTACCCCCGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthidium placitumsame genus7.8%Anthidium palmarumsame genus9.4%Anthidium jocosumsame genus9.4%Anthidium utahensesame genus9.4%Anthidium atrifronssame genus9.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type527 records

Wild obs. + sensor17

Museum / vouchered510

Range

Area of Occupancy AOO408 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 7≤1 km 4

11 georeferenced · 6 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 35≤1 km 7≤10 km 46>10 km 6

94 georeferenced · 416 without coordinates

Open the institutions mapphysical evidence510

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of California, Davislocation not on record	204
Wuzhou, CN	186
La Jolla, US	31
Champaign, US	25
San Diego, US	24
Cambridge, US	6
US	6
Beltsville, US	6
	6
Colorado State Universitylocation not on record	4
Santa Cruz, US	4
UFPRlocation not on record	3
University of Alabamalocation not on record	3
Santa Barbara Museum of Natural Historylocation not on record	1
University of Central Floridalocation not on record	1

15 institutions · 510 of 510 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Anthidium collectum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 13.0–16.5

Seasonal swing summer↔winter9.50 °C

Max temp (day)20.0 °C 19.3–21.2

Min temp (night)10.8 °C 7.00–12.4

Precipitation26.0 mm/mo 9.60–41.0

Air humidity61.0 % 54.6–63.2

Moisture balance-93.5 mm/mo -129–-70.1

Vapour deficit689 Pa 679–697

Wind speed1.60 m/s 1.60–1.70

Cloud cover26.9 % 24.0–42.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)