Anthidium utahense

Swenk, 1914 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Anthidium

At a glance

Occurrence records694

Data sources7

Biological traits2

DNA specimens36

eDNA detections36

Sources7 archives

Databases and archives Anthidium utahense's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility694 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF694 records

Environmental DNA1 datasets · 2 countries36 detections

DNA & barcodingBOLD36 specimens

01Narrative

Anthidium utahense is a species of bee in the family Megachilidae, the leaf-cutter, carder, or mason bees.Griswold, T., and J. S. Ascher., 2005, Checklist of Apoidea of North America (including Central America and the Caribbean)Catalogue of Life : 2009 Annual Checklist : Literature references

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology2

Intertegular distance (ITD)2.18 mm

Tongue length4.2 mm

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthidium utahense has left across the world's sequence archives.

At a glance

DNA specimens36

BINs1

Marker genes1

eDNA detections36

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

74Tmostly conserved

97Tvariable

118Tmostly conserved

475Cmostly conserved

631Amostly conserved

AATATTATATATAATCTTTGCCTTATGGTCCGGCATAATCGGATCCTCAATAAGAATAATTATTCGAATAGAATTAAGAACTCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.27%

Haplotypes4

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthidium placitumsame genus7.3%Anthidium emarginatumsame genus8.5%Anthidium jocosumsame genus8.5%Anthidium formosumsame genus9.0%Anthidium tenuifloraesame genus9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type694 records

Wild obs. + sensor4

Museum / vouchered690

Range

Area of Occupancy AOO724 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 2

3 georeferenced · 1 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤100 m 10≤1 km 19≤10 km 146>10 km 3

178 georeferenced · 512 without coordinates

Open the institutions mapphysical evidence690

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	199
Oregon State Arthropod Collectionlocation not on record	176
Champaign, US	127
Beltsville, US	48
	32
Santa Cruz, US	19
University of Alabamalocation not on record	19
University of Central Floridalocation not on record	13
San Diego, US	12
Weber State University, Bird and Mammal Collectionlocation not on record	8
Cambridge, US	7
Roberts Creek, CA	4
Royal Saskatchewan Museumlocation not on record	4
Provo, US	3
Colorado State Universitylocation not on record	3
US	2
La Jolla, US	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
WSUClocation not on record	2
UFPRlocation not on record	2
University of California, Riverside, Entomology Research Museumlocation not on record	1
Essig Museum of Entomologylocation not on record	1

22 institutions · 686 of 690 vouchered records shown · 4 without an institution code

09Environmental DNA36 detections

Where the DNA of Anthidium utahense was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map2 countries0

4. Native Grassland4. Native Grassland | 4.4. Temperate Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.9 °C 11.7–23.5

Seasonal swing summer↔winter24.7 °C

Max temp (day)27.6 °C 18.9–30.9

Min temp (night)14.2 °C 4.10–16.8

Precipitation28.7 mm/mo 2.20–42.1

Air humidity49.1 % 42.0–56.2

Moisture balance-126 mm/mo -180–-44.5

Vapour deficit1,225 Pa 728–1,688

Wind speed2.50 m/s 1.20–3.40

Cloud cover31.9 % 12.5–38.8

CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)