Anthidium jocosum

Cresson, 1878 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Anthidium

At a glance

Occurrence records1 005

Data sources7

Biological traits2

DNA specimens19

eDNA detections18

Sources7 archives

Databases and archives Anthidium jocosum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 005 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 005 records

Environmental DNA1 datasets · 2 countries18 detections

DNA & barcodingBOLD19 specimens

01Narrative

Anthidium jocosum is a species of bee in the family Megachilidae, the leaf-cutter, carder, or mason bees.Griswold, T., and J. S. Ascher., 2005, Checklist of Apoidea of North America (including Central America and the Caribbean)Catalogue of Life : 2009 Annual Checklist : Literature references

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology2

Intertegular distance (ITD)2.15 mm

Tongue length3.9 mm

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthidium jocosum has left across the world's sequence archives.

At a glance

DNA specimens19

BINs2

Marker genes1

eDNA detections18

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 43 variable positions, in barcode order

10Tmostly conserved

30Cmostly conserved

34Tmostly conserved

40Tmostly conserved

64Cmostly conserved

74Cvariable

115Cmostly conserved

121Tmostly conserved

136Tmostly conserved

139Cvariable

169Tmostly conserved

172Tmostly conserved

173Tmostly conserved

181Tmostly conserved

205Cmostly conserved

218Amostly conserved

226Cmostly conserved

238Tmostly conserved

271Cmostly conserved

278Cmostly conserved

316Amostly conserved

325Tmostly conserved

367Cmostly conserved

373Amostly conserved

449Gmostly conserved

499Cmostly conserved

505Cmostly conserved

508Cmostly conserved

530Gvariable

533Cmostly conserved

536Tmostly conserved

538Amostly conserved

541Cmostly conserved

556Tmostly conserved

559Amostly conserved

568Cmostly conserved

571Cmostly conserved

596Cmostly conserved

619Amostly conserved

631Tmostly conserved

634Cvariable

646Cvariable

652Cvariable

AATATTATATATAATTTTTGCTTTATGATCTGGTATAATTGGATCTTCAATAAGAATAATTATCCGAATAGAACTAAGAACACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.5%

Haplotypes4

BINs2

Most divergent pair6.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthidium utahensesame genus8.5%Anthidium placitumsame genus8.7%Anthidium emarginatumsame genus9.1%Anthidium tenuifloraesame genus9.3%Anthidium collectumsame genus9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 005 records

Wild obs. + sensor1

Museum / vouchered1 004

Range

Area of Occupancy AOO248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy98% within 1 km

≤100 m 531≤1 km 11≤10 km 6>10 km 7

555 georeferenced · 449 without coordinates

Open the institutions mapphysical evidence1 004

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alabamalocation not on record	598
La Jolla, US	370
	19
San Diego, US	8
US	2
Champaign, US	2
Cambridge, US	1
University of California, Riverside, Entomology Research Museumlocation not on record	1
US	1
Wuzhou, CN	1
ASUlocation not on record	1

11 institutions · 1 004 of 1 004 vouchered records shown

09Environmental DNA18 detections

Where the DNA of Anthidium jocosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.7 °C 17.9–27.6

Seasonal swing summer↔winter16.4 °C

Max temp (day)30.2 °C 23.7–34.6

Min temp (night)17.2 °C 11.3–19.8

Precipitation6.70 mm/mo 1.80–10.6

Air humidity41.2 % 36.6–61.0

Moisture balance-195 mm/mo -213–-143

Vapour deficit1,534 Pa 867–2,342

Wind speed3.20 m/s 1.50–4.40

Cloud cover16.1 % 12.4–23.4

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthidium jocosum

At a glance

Sources7 archives

Size & morphology2

At a glance

Record type1 005 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 005 records