Anthidium florentinum

(Fabricius, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Anthidium

At a glance

Occurrence records6 715

Data sources7

Biological traits2

DNA specimens38

eDNA detections53

Sources7 archives

Databases and archives Anthidium florentinum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 715 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI53 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF6 715 records

Environmental DNA1 datasets · 14 countries53 detections

DNA & barcodingBOLD38 specimens

01Narrative

Anthidium helianthinum is a species of bee in the family Megachilidae, the leaf-cutter, carder, or mason bees.Griswold, T., and J. S. Ascher., 2005, Checklist of Apoidea of North America (including Central America and the Caribbean)Catalogue of Life : 2009 Annual Checklist : Literature references

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology2

Body length1.55 cm

Intertegular distance (ITD)4.3 mm

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthidium florentinum has left across the world's sequence archives.

At a glance

DNA specimens38

BINs4

Marker genes2

eDNA detections53

Countries14

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus37 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 36 variable positions, in barcode order

43Tmostly conserved

49Avariable

82Tmostly conserved

85Tmostly conserved

127Tvariable

163Avariable

181Avariable

184Gvariable

193Tmostly conserved

212Avariable

214Gvariable

217Tvariable

232Avariable

235Tmostly conserved

251Amostly conserved

266Tmostly conserved

271Tvariable

313Avariable

316Tvariable

343Tvariable

373Amostly conserved

386Tmostly conserved

394Tmostly conserved

406Tmostly conserved

418Tvariable

451Tvariable

479Tvariable

486Tvariable

544Avariable

547Amostly conserved

568Tmostly conserved

581Tmostly conserved

598Tvariable

616Tmostly conserved

619Amostly conserved

631Tvariable

TATATTATATATAATTTTTGCTTTATGAGCAGGAATAATTGGTTCATCAATAAGAATAATTATTCGAATAGAATTAAGTATTCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes5

BINs4

Most divergent pair3.5%

AsiaN.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthidium septemspinosumsame genus6.3%Anthidium manicatumsame genus9.3%Anthidium funereumsame genus9.9%Anthidium palmarumsame genus10.0%Anthidium qingtaoisame genus10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PLWRHO

animal barcodemarker

08Occurrence & distribution

Record type6 715 records

Wild obs. + sensor4 897

Museum / vouchered1 050

Other768

Origin

Native71

Range

Area of Occupancy AOO11 944 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 2 301≤1 km 589≤10 km 297>10 km 190

3 377 georeferenced · 1 520 without coordinates

Open the mapobservation + sensor4 897

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 9≤1 km 37≤10 km 143>10 km 3

192 georeferenced · 858 without coordinates

Open the institutions mapphysical evidence1 050

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	673
Philadelphia, US	65
Helsinki, FI	46
	42
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	33
Zürich, CH	25
NMOKlocation not on record	23
Coimbra, PT	16
Muzeum Górnośląskie w Bytomiulocation not on record	14
USALlocation not on record	7
Museu Nacional de História Natural e da Ciêncialocation not on record	6
Wuzhou, CN	4
ZSMlocation not on record	2
Musee d'Histoire Naturallelocation not on record	2
US	2
Provincia di Livornolocation not on record	2
IMEDEAlocation not on record	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Cambridge, US	1
Banyoles, ES	1
Espace pour la vielocation not on record	1
Radicondoli, IT	1

22 institutions · 968 of 1 050 vouchered records shown · 81 without an institution code

09Environmental DNA53 detections

Where the DNA of Anthidium florentinum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found53

Studies independent surveys1

Countries14

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 53 detections have coordinates

Open the map14 countries0

85City parks and large gardensCity parks and gardensFriche

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.8 °C 6.20–24.0

Seasonal swing summer↔winter25.0 °C

Max temp (day)19.9 °C 10.2–28.9

Min temp (night)8.80 °C -0.1–18.2

Precipitation41.8 mm/mo 19.3–101

Air humidity53.9 % 48.3–59.9

Moisture balance-84.9 mm/mo -154–14.5

Vapour deficit930 Pa 415–1,409

Wind speed2.90 m/s 1.50–3.90

Cloud cover35.3 % 19.5–57.9

CHELSA 1981–2010, ~9 km grid, at location & month of 53 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthidium florentinum

At a glance

Sources7 archives

Size & morphology2

At a glance

Record type6 715 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 715 records