Anthidium edwardsii

Cresson, 1878 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Anthidium

At a glance

Occurrence records263

Data sources7

Biological traits0

DNA specimens4

eDNA detections7

Sources7 archives

Databases and archives Anthidium edwardsii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility263 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF263 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD4 specimens

01Narrative

Anthidium edwardsii is a species of bee in the family Megachilidae, the leaf-cutter, carder, or mason bees.Griswold, T., and J. S. Ascher., 2005, Checklist of Apoidea of North America (including Central America and the Caribbean)Catalogue of Life : 2009 Annual Checklist : Literature references

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthidium edwardsii has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

214Gmostly conserved

376Amostly conserved

472Cmostly conserved

547Tmostly conserved

571Cmostly conserved

AATATTATATATAATTTTTGCTTTATGAGCCGGCATAATCGGTTCCTCAATAAGAATAATTATTCGAATAGAATTAAGTACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.38%

Haplotypes3

BIN1

Most divergent pair0.46%

OtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthidium placitumsame genus10.7%Anthidium collectumsame genus10.8%Anthidium jocosumsame genus11.1%Anthidium utahensesame genus11.4%Anthidium palmarumsame genus11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type263 records

Wild obs. + sensor10

Museum / vouchered253

Range

Area of Occupancy AOO316 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 7≤1 km 2

9 georeferenced · 1 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 11≤10 km 85>10 km 1

97 georeferenced · 156 without coordinates

Open the institutions mapphysical evidence253

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	76
	75
Champaign, US	71
La Jolla, US	11
Cambridge, US	9
San Diego, US	3
Universidad Católica de Manizaleslocation not on record	3
Colorado State Universitylocation not on record	2
UFPRlocation not on record	2
University of Central Floridalocation not on record	1

10 institutions · 253 of 253 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Anthidium edwardsii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 14.2–19.9

Seasonal swing summer↔winter21.6 °C

Max temp (day)24.6 °C 21.4–27.9

Min temp (night)8.90 °C 6.80–12.0

Precipitation14.2 mm/mo 11.1–17.6

Air humidity45.9 % 40.1–49.9

Moisture balance-155 mm/mo -184–-141

Vapour deficit1,119 Pa 878–1,221

Wind speed2.70 m/s 1.70–4.60

Cloud cover28.5 % 12.8–32.5

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)