Andrena barbara

Bouseman & LaBerge, 1979 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records2 804

Data sources7

Biological traits1

DNA specimens8

eDNA detections6

Sources7 archives

Databases and archives Andrena barbara's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 804 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF2 804 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD8 specimens

01Narrative

Andrena barbara, or Barbara's miner, is a species of mining bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.5 mm

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena barbara has left across the world's sequence archives.

At a glance

DNA specimens8

BINs2

Marker genes1

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 52 variable positions, in barcode order

19Tvariable

28Gvariable

38Avariable

43Amostly conserved

55Gvariable

67Cmostly conserved

74Tmostly conserved

97Tmostly conserved

121Amostly conserved

124Tmostly conserved

154Tmostly conserved

172Cmostly conserved

250Tmostly conserved

263Cmostly conserved

281Cmostly conserved

293Cvariable

343Avariable

349Tmostly conserved

355Tmostly conserved

361Tmostly conserved

367Tmostly conserved

394Cmostly conserved

397Tmostly conserved

403Tmostly conserved

406Tmostly conserved

409Tmostly conserved

412Amostly conserved

415Cmostly conserved

418Tmostly conserved

427Tmostly conserved

433Tvariable

442Tmostly conserved

451Amostly conserved

463Tmostly conserved

484Tmostly conserved

490Cmostly conserved

499Cmostly conserved

517Amostly conserved

520Cmostly conserved

523Tmostly conserved

536Tmostly conserved

538Amostly conserved

539Cmostly conserved

548Cmostly conserved

550Tmostly conserved

562Tmostly conserved

596Tmostly conserved

631Avariable

634Cmostly conserved

637Cmostly conserved

640Cvariable

649Avariable

AATATTATATTTCATTTTTGCCATATGGGCAGGAATAATTGGAGCATCTCTAAGGTTCATCATTCGCATAGAATTAAGAAATCCAGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.5%

Haplotypes4

BINs2

Most divergent pair7.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena dunningisame genus8.9%Andrena transnigrasame genus9.4%Andrena prunisame genus9.8%Andrena solasame genus10.0%Andrena regularissame genus10.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 804 records

Wild obs. + sensor269

Museum / vouchered2 535

Range

Area of Occupancy AOO2 040 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 162≤1 km 36≤10 km 2>10 km 40

240 georeferenced · 29 without coordinates

Open the mapobservation + sensor269

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤100 m 1≤1 km 30≤10 km 367>10 km 1

399 georeferenced · 2 136 without coordinates

Open the institutions mapphysical evidence2 535

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
US	1 607
Champaign, US	404
	113
North Carolina State University Insect Museumlocation not on record	85
University Park, US	70
Wuzhou, CN	69
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	68
Lexington, US	30
WIlocation not on record	27
Cleveland Museum of Natural History, OH (CLEV)location not on record	19
Philadelphia, US	11
Cornell University Insect Collectionlocation not on record	8
Beltsville, US	7
Chicago, US	4
Colorado State Universitylocation not on record	3
University of Central Floridalocation not on record	2
ZSMlocation not on record	2
Blacksburg, US	1
WSUClocation not on record	1
New Haven, US	1

20 institutions · 2 532 of 2 535 vouchered records shown · 3 without an institution code

09Environmental DNA6 detections

Where the DNA of Andrena barbara was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.0 °C 12.7–16.2

Seasonal swing summer↔winter24.0 °C

Max temp (day)18.4 °C 18.0–21.7

Min temp (night)8.00 °C 7.30–11.9

Precipitation99.5 mm/mo 95.9–105

Air humidity55.2 % 54.8–55.4

Moisture balance-12.9 mm/mo -46.0–-7.50

Vapour deficit672 Pa 666–830

Wind speed4.10 m/s 3.40–6.20

Cloud cover44.8 % 39.0–46.1

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena barbara

At a glance

Sources7 archives

Size & morphology1

At a glance

Record type2 804 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 804 records