Andrena dunningi

Cockerell, 1898 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records2 643

Data sources8

Biological traits1

DNA specimens36

eDNA detections39

Sources8 archives

Databases and archives Andrena dunningi's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 643 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI39 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.49 Gbp↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF2 643 records

Environmental DNA1 datasets · 1 countries39 detections

DNA & barcodingBOLD36 specimens

Genome at a glanceGoaT489 Mbp

01Narrative

The Dunning's miner bee (Andrena dunningi) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.47 mm

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena dunningi has left across the world's sequence archives.

At a glance

DNA specimens36

BINs1

Marker genes1

eDNA detections39

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

337Amostly conserved

385Cmostly conserved

511Avariable

581Cvariable

AATACTATATTTCATTTTCGCTATATGAGCAGGAATAGTCGGAGCCTCTCTAAGATTAATTATCCGAATAGAATTAAGAAACCCCGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.22%

Haplotypes5

BIN1

Most divergent pair0.30%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena regularissame genus8.8%Andrena barbarasame genus8.9%Andrena prunisame genus9.3%Andrena transnigrasame genus9.7%Andrena vagasame genus9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Andrena dunningi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size489 000 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Andrena dunningi0.49 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidy♂1× / ♀2× by sex

08Occurrence & distribution

Record type2 643 records

Wild obs. + sensor1 274

Museum / vouchered1 369

Range

Area of Occupancy AOO3 996 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 652≤1 km 210≤10 km 61>10 km 160

1 083 georeferenced · 191 without coordinates

Open the mapobservation + sensor1 274

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 14≤1 km 72≤10 km 191>10 km 6

283 georeferenced · 1 086 without coordinates

Open the institutions mapphysical evidence1 369

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University Park, US	331
WIlocation not on record	234
Cornell University Insect Collectionlocation not on record	157
	107
US	74
Champaign, US	64
White River Junction, US	51
New Haven, US	31
UNHClocation not on record	29
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	28
Cambridge, US	26
St. Paul, US	18
Zadock Thompson Natural History Collection, University of Vermontlocation not on record	16
Beltsville, US	14
LULlocation not on record	12
Wuzhou, CN	10
Saint John, CA	9
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8
FWSlocation not on record	7
Toronto, CA	6
OSUClocation not on record	5
Toronto, CA	4
Chicago, US	3
Washington, US	1
Lexington, US	1
CUlocation not on record	1
Blacksburg, US	1
University of Alabamalocation not on record	1
New Haven, US	1

29 institutions · 1 250 of 1 369 vouchered records shown · 119 without an institution code

09Environmental DNA39 detections

Where the DNA of Andrena dunningi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found39

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 39 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.20 °C 5.50–15.2

Seasonal swing summer↔winter26.1 °C

Max temp (day)11.9 °C 10.1–19.5

Min temp (night)2.60 °C 1.30–11.8

Precipitation83.5 mm/mo 73.1–99.3

Air humidity59.6 % 55.5–61.5

Moisture balance-8.30 mm/mo -42.4–41.6

Vapour deficit451 Pa 416–661

Wind speed3.30 m/s 2.70–4.80

Cloud cover49.9 % 45.6–57.0

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena dunningi

At a glance

Sources8 archives

Size & morphology1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type2 643 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions18 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 643 records