Andrena regularis

Malloch, 1917 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records454

Data sources7

Biological traits1

DNA specimens21

eDNA detections21

Sources7 archives

Databases and archives Andrena regularis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility454 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF454 records

Environmental DNA1 datasets · 1 countries21 detections

DNA & barcodingBOLD21 specimens

01Narrative

The regular miner bee (Andrena regularis) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)3.1 mm

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena regularis has left across the world's sequence archives.

At a glance

DNA specimens21

BINs1

Marker genes1

eDNA detections21

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.03%

Haplotypes2

BIN1

Most divergent pair0.15%

ATGCTATATTTCATTTTTGCCATATGAGCAGGAATAGTTGGTGCCTCTTTAAGATTCATTATTCGTATAGAATTAAGAAACCCGGGAAAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena dunningisame genus8.8%Andrena prunisame genus9.4%Andrena transnigrasame genus10.2%Andrena barbarasame genus10.3%Andrena cinerariasame genus10.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type454 records

Wild obs. + sensor17

Museum / vouchered437

Range

Area of Occupancy AOO688 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 10≤1 km 5

15 georeferenced · 2 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 6≤1 km 25≤10 km 84>10 km 3

118 georeferenced · 319 without coordinates

Open the institutions mapphysical evidence437

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cornell University Insect Collectionlocation not on record	125
Cambridge, US	36
Wuzhou, CN	34
	29
WIlocation not on record	28
White River Junction, US	27
US	24
Champaign, US	23
LULlocation not on record	16
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	14
Zadock Thompson Natural History Collection, University of Vermontlocation not on record	14
UNHClocation not on record	13
New Haven, US	12
St. Paul, US	11
New Haven, US	6
Beltsville, US	6
JMLlocation not on record	1
WSUClocation not on record	1
University Park, US	1
University of Central Floridalocation not on record	1

20 institutions · 422 of 437 vouchered records shown · 15 without an institution code

09Environmental DNA21 detections

Where the DNA of Andrena regularis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 11.5–16.8

Seasonal swing summer↔winter34.6 °C

Max temp (day)22.7 °C 18.1–22.7

Min temp (night)11.9 °C 6.10–11.9

Precipitation87.2 mm/mo 80.2–90.7

Air humidity57.0 % 55.4–60.6

Moisture balance-58.5 mm/mo -58.5–-25.9

Vapour deficit827 Pa 615–827

Wind speed4.50 m/s 3.20–4.60

Cloud cover41.0 % 41.0–48.5

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)