Andrena pruni

Robertson, 1891 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records1 497

Data sources7

Biological traits3

DNA specimens5

eDNA detections5

Sources7 archives

Databases and archives Andrena pruni's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 497 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF1 497 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

Andrena pruni, the cherry miner, is a species of mining bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology3

Body length0.94 cm

Intertegular distance (ITD)2.4 mm

Wing length9 mm

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena pruni has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AATATTATATTTCATCTTCGCTATATGAGCAGGAATAATTGGTGCATCCTTAAGATTCATTATTCGAATAGAACTAAGAAATCCAGGAAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena cinerariasame genus8.8%Andrena transnigrasame genus9.0%Andrena solasame genus9.2%Andrena dunningisame genus9.3%Andrena regularissame genus9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 497 records

Wild obs. + sensor89

Museum / vouchered1 408

Range

Area of Occupancy AOO1 516 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 42≤1 km 23≤10 km 3>10 km 12

80 georeferenced · 9 without coordinates

Open the mapobservation + sensor89

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 9≤1 km 27≤10 km 63>10 km 1

100 georeferenced · 1 308 without coordinates

Open the institutions mapphysical evidence1 408

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
US	887
	172
University Park, US	90
Champaign, US	56
New Haven, US	35
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	30
White River Junction, US	21
OSUClocation not on record	14
LULlocation not on record	13
Cornell University Insect Collectionlocation not on record	12
WIlocation not on record	9
UNHClocation not on record	8
New Haven, US	8
Wuzhou, CN	8
Beltsville, US	8
Cleveland Museum of Natural History, OH (CLEV)location not on record	7
Philadelphia, US	7
Cambridge, US	5
Blacksburg, US	3
Zadock Thompson Natural History Collection, University of Vermontlocation not on record	2
SUNY ESFlocation not on record	2
Lexington, US	1
Washington, US	1
Decorah, US	1

24 institutions · 1 400 of 1 408 vouchered records shown · 8 without an institution code

09Environmental DNA5 detections

Where the DNA of Andrena pruni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

1. Forest & Woodland|1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 11.2–11.2

Seasonal swing summer↔winter23.3 °C

Max temp (day)17.1 °C

Min temp (night)5.20 °C

Precipitation91.3 mm/mo

Air humidity53.1 %

Moisture balance-7.50 mm/mo

Vapour deficit628 Pa

Wind speed3.50 m/s

Cloud cover45.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena pruni

At a glance

Sources7 archives

Size & morphology3

At a glance

Record type1 497 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 497 records