Andrena transnigra

Viereck, 1904 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records569

Data sources7

Biological traits1

DNA specimens21

eDNA detections48

Sources7 archives

Databases and archives Andrena transnigra's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility569 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI48 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF569 records

Environmental DNA1 datasets · 2 countries48 detections

DNA & barcodingBOLD21 specimens

01Narrative

The black-banded miner bee (Andrena transnigra) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.63 mm

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena transnigra has left across the world's sequence archives.

At a glance

DNA specimens21

BINs1

Marker genes1

eDNA detections48

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

403Tmostly conserved

418Cmostly conserved

461Amostly conserved

497Cmostly conserved

499Tmostly conserved

523Cmostly conserved

577Gmostly conserved

634Cmostly conserved

AATACTTTACTTTATTTTCGCTATATGAGCAGGAATAGTTGGAGCATCTCTAAGATTCATTATTCGCATAGAATTAAGAAATCCAGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.18%

Haplotypes4

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena prunisame genus9.0%Andrena barbarasame genus9.4%Andrena dunningisame genus9.7%Andrena cinerariasame genus10.0%Andrena solasame genus10.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type569 records

Wild obs. + sensor10

Museum / vouchered559

Range

Area of Occupancy AOO920 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 5≤1 km 3≤10 km 1

9 georeferenced · 1 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 14≤1 km 6≤10 km 38>10 km 4

62 georeferenced · 497 without coordinates

Open the institutions mapphysical evidence559

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	298
Wuzhou, CN	47
US	42
Champaign, US	31
Weber State University, Bird and Mammal Collectionlocation not on record	25
	22
Royal Saskatchewan Museumlocation not on record	19
BBSLlocation not on record	11
WIlocation not on record	8
PCYUlocation not on record	6
Colorado State Universitylocation not on record	5
Vancouver, CA	5
Edmonton, CA	4
OSUClocation not on record	4
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	4
New Haven, US	4
Toronto, CA	3
Nelson, CA	3
Provo, US	3
Natural History Museum of Utahlocation not on record	3
University of Central Floridalocation not on record	2
Oregon State Arthropod Collectionlocation not on record	2
Alberta Environment and Parkslocation not on record	2
Cambridge, US	2
Philadelphia, US	1
Chicago, US	1
WSUClocation not on record	1

27 institutions · 558 of 559 vouchered records shown · 1 without an institution code

09Environmental DNA48 detections

Where the DNA of Andrena transnigra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found48

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 48 detections have coordinates

Open the map2 countries0

4. Native GrasslandPost-fire forestAgricultural fieldagricultural field

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.6 °C 3.00–14.1

Seasonal swing summer↔winter24.1 °C

Max temp (day)16.7 °C 8.20–20.1

Min temp (night)3.90 °C -2.90–8.30

Precipitation39.6 mm/mo 26.2–70.0

Air humidity52.8 % 46.1–55.3

Moisture balance-61.1 mm/mo -95.1–-16.7

Vapour deficit627 Pa 377–785

Wind speed2.70 m/s 1.40–6.90

Cloud cover42.1 % 31.6–50.3

CHELSA 1981–2010, ~9 km grid, at location & month of 47 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)