Anacampsis nonstrigella

Busck, 1906 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Anacampsis

At a glance

Occurrence records35

Data sources7

Biological traits0

DNA specimens4

eDNA detections0

Sources7 archives

Databases and archives Anacampsis nonstrigella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility35 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF35 records

DNA & barcodingBOLD4 specimens

01Narrative

Anacampsis nonstrigella is a moth of the family Gelechiidae. It was described by August Busck in 1906. It is found in North America, where it has been recorded from Pennsylvania, Indiana, Kentucky and Maine."Anacampsis Curtis, 1827" at Markku Savela's Lepidoptera and Some Other Life Forms. Retrieved July 6, 2017.Moth Photographers Group The wingspan is about 15 mm. The basal two-thirds of the forewings are dark olive, the apical part deep blackish brown, with a few golden-brown scales just before the apex. The hindwings are dark purplish fuscous, with the dorsal cilia white.The Canadian Entomologist 38 (4): 121

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anacampsis nonstrigella has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.71%

Haplotypes2

BIN1

Most divergent pair0.30%

Where individuals differ — all 9 variable positions, in barcode order

31Cmostly conserved

58Amostly conserved

214Avariable

334Cmostly conserved

466Amostly conserved

505Tmostly conserved

622Tmostly conserved

633Amostly conserved

635Cmostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCCGGAATAGTTGGTACTTCTTTAAGTTTATTAATTCGGGCAGAATTAGGAAATCCAGGACA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anacampsis agrimoniellasame genus1.7%Anacampsis timidellasame genus5.6%Anacampsis niveopulvellasame genus6.4%Anacampsis blattariellasame genus6.5%Anacampsis populellasame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type35 records

Wild obs. + sensor34

Museum / vouchered1

Range

Area of Occupancy AOO104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 25≤1 km 7>10 km 1

33 georeferenced · 1 without coordinates

Open the mapobservation + sensor34

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	1

1 institutions · 1 of 1 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)