Anacampsis agrimoniella

(Clemens, 1860) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Anacampsis

At a glance

Occurrence records309

Data sources8

Biological traits0

DNA specimens32

eDNA detections37

Sources8 archives

Databases and archives Anacampsis agrimoniella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility309 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF309 records

Environmental DNA1 datasets · 2 countries37 detections

DNA & barcodingBOLD32 specimens

01Narrative

Anacampsis agrimoniella is a moth of the family Gelechiidae. It was described by James Brackenridge Clemens in 1860. It is found in North America, where it has been recorded from Ontario and New York south to Florida, west to Illinois.Moth Photographers Group. Mississippi State University. The habitat consists of woodlands and wood edges. The wingspan is 10–12 mm. The basal half of the forewings is medium gray, while the apical half is dark gray to blackish. A thick white band crosses the wing about two-thirds from the base, with the inner margin of the band straight-edged and the outer margin broadening at the costa. The larvae feed on Agrimonia species.Bug Guide

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anacampsis agrimoniella has left across the world's sequence archives.

At a glance

DNA specimens32

BINs1

Marker genes1

eDNA detections37

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

31Amostly conserved

58Gvariable

59Cmostly conserved

61Amostly conserved

67Gmostly conserved

214Amostly conserved

334Tmostly conserved

346Cmostly conserved

352Amostly conserved

355Tmostly conserved

466Amostly conserved

526Tmostly conserved

529Cmostly conserved

536Tmostly conserved

562Cmostly conserved

578Tmostly conserved

616Cmostly conserved

628Gmostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGTACTTCTTTAAGTTTGCTAATTCGGGCAGAATTAGGAAATCCAGGACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes10

BIN1

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anacampsis nonstrigellasame genus1.7%Anacampsis timidellasame genus5.6%Anacampsis niveopulvellasame genus6.1%Anacampsis obscurellasame genus6.2%Anacampsis blattariellasame genus6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type309 records

Wild obs. + sensor273

Museum / vouchered36

Range

Area of Occupancy AOO824 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 136≤1 km 72≤10 km 12>10 km 12

232 georeferenced · 41 without coordinates

Open the mapobservation + sensor273

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 17

17 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence36

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	17
Washington, US	8
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
Mississippi State, US	1
CUlocation not on record	1

5 institutions · 32 of 36 vouchered records shown · 4 without an institution code

09Environmental DNA37 detections

Where the DNA of Anacampsis agrimoniella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map2 countries0

Forest1. Forest & Woodland|1.1 Boreal ForestMixed Habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 17.1–20.8

Seasonal swing summer↔winter26.4 °C

Max temp (day)23.6 °C 20.4–25.5

Min temp (night)15.0 °C 14.4–17.9

Precipitation95.4 mm/mo 78.2–105

Air humidity59.9 % 57.4–61.0

Moisture balance-40.8 mm/mo

Vapour deficit910 Pa 758–989

Wind speed3.20 m/s

Cloud cover40.1 % 38.3–54.6

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)