Anacampsis blattariella

(Hübner, 1796) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Anacampsis

At a glance

Occurrence records5 714

Data sources10

Biological traits2

DNA specimens48

eDNA detections215

Sources10 archives

Databases and archives Anacampsis blattariella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 714 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI215 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics48 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF5 714 records

Environmental DNA3 datasets · 10 countries215 detections

DNA & barcodingBOLD48 specimens

Genome at a glanceGoaT · NCBI≈588 Mbp

01Narrative

Anacampsis blattariella, the birch sober, is a moth of the family Gelechiidae. It is found in most of Europe, except Ireland, the Iberian Peninsula and most of the Balkan Peninsula.Fauna Europaea The wingspan is 16–19 mm. Adults are on wing from July to September.UK Moths The larvae feed on Betula species. They roll a leaf of their host plant longitudinally along the midrib. Larvae can be found in May and June. Pupation takes place in the larval feeding place.Lepidoptera of Belgium

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding48 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anacampsis blattariella has left across the world's sequence archives.

At a glance

DNA specimens48

BINs2

Marker genes1

eDNA detections215

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus44 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)0.36%

Haplotypes2

BINs2

Most divergent pair2.6%

Where individuals differ — all 17 variable positions, in barcode order

40Cmostly conserved

49Cmostly conserved

79Amostly conserved

278Cmostly conserved

307Amostly conserved

340Cmostly conserved

352Amostly conserved

385Cmostly conserved

433Amostly conserved

477Gmostly conserved

478Tmostly conserved

508Tmostly conserved

532Gmostly conserved

536Cmostly conserved

539Tmostly conserved

541Amostly conserved

616Cmostly conserved

AACTTTATATTTCATTTTTGGTATTTGAGCAGGAATAGTCGGTACTTCCTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCAGGACA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anacampsis populellasame genus2.4%Anacampsis niveopulvellasame genus2.7%Anacampsis innocuellasame genus4.4%Anacampsis timidellasame genus5.9%Anacampsis solemnellasame genus6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Anacampsis blattariella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈588 009 231 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anacampsis blattariella0.59 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.6% BUSCO

08Occurrence & distribution

Record type5 714 records

Wild obs. + sensor5 096

Museum / vouchered607

Other11

Range

Area of Occupancy AOO9 432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 2 313≤1 km 1 455≤10 km 1 034>10 km 11

4 813 georeferenced · 283 without coordinates

Open the mapobservation + sensor5 096

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 213≤1 km 244≤10 km 31

488 georeferenced · 119 without coordinates

Open the institutions mapphysical evidence607

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	106
Provincia di Livornolocation not on record	74
NHMOlocation not on record	67
SLU Artdatabankenlocation not on record	48
Tartu, EE	42
Kuopio, FI	33
Stockholm, SE	25
Salzburg, AT	15
Tilburg, NL	10
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	9
Tallinn, EE	9
Nijmegen, NL	9
National Institute of Biological Resourceslocation not on record	9
Trondheim, NO	7
Durban Natural Science Museumlocation not on record	6
Rovaniemi, FI	4
BioFokuslocation not on record	4
ZSMlocation not on record	3
NTNU-VMlocation not on record	3
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	3
Natural History Museum Rotterdamlocation not on record	3
Bavarian State Collection of Zoologylocation not on record	3
Metsähallituslocation not on record	2
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
ZMAAlocation not on record	1
South Kensington, GB	1
MZLUlocation not on record	1

29 institutions · 501 of 607 vouchered records shown · 106 without an institution code

09Environmental DNA215 detections

Where the DNA of Anacampsis blattariella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found215

Studies independent surveys3

Countries10

Verifiable raw sequence linked172

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 215 detections have coordinates

Open the map10 countries0

Hay meadowAcer campestre

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 8.50–17.2

Seasonal swing summer↔winter22.5 °C

Max temp (day)18.5 °C 12.0–21.3

Min temp (night)11.4 °C 5.60–13.4

Precipitation91.6 mm/mo 60.9–103

Air humidity60.9 % 58.2–63.6

Moisture balance2.40 mm/mo -47.7–39.2

Vapour deficit661 Pa 403–810

Wind speed2.60 m/s 1.80–3.30

Cloud cover51.3 % 39.3–56.5

CHELSA 1981–2010, ~9 km grid, at location & month of 215 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anacampsis blattariella

At a glance

Sources10 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type5 714 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 714 records