Anacampsis populella

(Clerck, 1759) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Anacampsis

At a glance

Occurrence records3 784

Data sources9

Biological traits2

DNA specimens57

eDNA detections285

Sources9 archives

Databases and archives Anacampsis populella's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 784 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI285 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics57 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 784 records

Environmental DNA3 datasets · 12 countries285 detections

DNA & barcodingBOLD57 specimens

Genome at a glanceGoaT2n = 58

01Narrative

Anacampsis populella is a moth of the family Gelechiidae, which is native to Europe and has been accidentally introduced to North America. It was first described in 1759 by Carl Alexander Clerck, a Swedish entomologist. The type specimen is from Sweden. The foodplants of the larvae are poplars (Populus species) and willows (Salix species).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding57 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anacampsis populella has left across the world's sequence archives.

At a glance

DNA specimens57

BINs1

Marker genes2

eDNA detections285

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus53 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

79Gmostly conserved

136Cmostly conserved

142Tmostly conserved

235Tmostly conserved

274Tmostly conserved

337Amostly conserved

352Tmostly conserved

433Gmostly conserved

478Tmostly conserved

574Tmostly conserved

628Amostly conserved

646Cmostly conserved

AACTTTATATTTCATTTTTGGTATTTGAGCAGGAATAGTAGGTACTTCCTTAAGTTTATTAATTCGAGCAGAATTAGGGAATCCAGGACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.39%

Haplotypes6

BIN1

Most divergent pair1.5%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anacampsis blattariellasame genus2.4%Anacampsis niveopulvellasame genus3.2%Anacampsis innocuellasame genus4.9%Anacampsis solemnellasame genus6.4%Anacampsis temerellasame genus6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Anacampsis populella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 58 n = 29

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 291×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

2n 581×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type3 784 records

Wild obs. + sensor2 896

Museum / vouchered850

Other38

Origin

Native6

Range

Area of Occupancy AOO7 844 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 1 121≤1 km 780≤10 km 885>10 km 6

2 792 georeferenced · 104 without coordinates

Open the mapobservation + sensor2 896

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 341≤1 km 276≤10 km 105>10 km 1

723 georeferenced · 127 without coordinates

Open the institutions mapphysical evidence850

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	120
NHMOlocation not on record	103
Provincia di Livornolocation not on record	72
Tartu, EE	62
SLU Artdatabankenlocation not on record	52
Tromsø, NO	30
Kuopio, FI	23
Natural History Museum Rotterdamlocation not on record	18
Stockholm, SE	15
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	15
Nijmegen, NL	12
Philadelphia, US	12
Salzburg, AT	11
Tilburg, NL	11
National Institute of Biological Resourceslocation not on record	10
Rovaniemi, FI	8
Durban Natural Science Museumlocation not on record	8
Uniwersytet Łódzkilocation not on record	6
neflocation not on record	6
NTNU-VMlocation not on record	6
Tallinn, EE	5
Trondheim, NO	5
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	5
Albuquerque, US	4
BioFokuslocation not on record	4
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	4
ZSMlocation not on record	3
St. Paul, US	3
South Kensington, GB	3
Helsinki, FI	3
Iwate Prefectural Museumlocation not on record	2
DABUHlocation not on record	2
ZMAAlocation not on record	2
Metsähallituslocation not on record	1
MZLUlocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
University of Kaiserslauternlocation not on record	1

37 institutions · 649 of 850 vouchered records shown · 201 without an institution code

09Environmental DNA285 detections

Where the DNA of Anacampsis populella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found285

Studies independent surveys3

Countries12

Verifiable raw sequence linked193

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 285 detections have coordinates

Open the map12 countries0

1.1. Boreal Forest|1. Forest & WoodlandforestFloodplain forestMixed forest on sandy soil

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 11.0–17.4

Seasonal swing summer↔winter19.5 °C

Max temp (day)19.2 °C 14.8–21.8

Min temp (night)12.2 °C 7.20–13.9

Precipitation74.0 mm/mo 54.7–106

Air humidity60.9 % 58.0–63.3

Moisture balance-17.1 mm/mo -57.8–28.4

Vapour deficit679 Pa 487–828

Wind speed2.90 m/s 2.20–3.80

Cloud cover46.1 % 35.4–55.1

CHELSA 1981–2010, ~9 km grid, at location & month of 269 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anacampsis populella

At a glance

Sources9 archives

Diet & foraging2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 784 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 37 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 784 records