Anacampsis innocuella

(Zeller, 1873) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Anacampsis

At a glance

Occurrence records115

Data sources8

Biological traits0

DNA specimens23

eDNA detections23

Sources8 archives

Databases and archives Anacampsis innocuella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility115 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF115 records

Environmental DNA1 datasets · 1 countries23 detections

DNA & barcodingBOLD23 specimens

01Narrative

Anacampsis innocuella, the dark-headed aspen leafroller moth, is a moth of the family Gelechiidae. It was described by Philipp Christoph Zeller in 1873. It is found in North America, where it has been recorded from Alabama, British Columbia, Illinois, Indiana, Maine, Mississippi, New York, Nova Scotia, Ohio, Oklahoma, Ontario, Quebec and Vermont.funet.fimothphotographersgroup The wingspan is 18–22 mm. Adults are ash grey with a pale wavy transverse line on the forewings. The larvae feed on Populus, Salix and Prunus species, rolling the leaves of their host plant.Insects of Eastern Forests

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anacampsis innocuella has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections23

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

22Cmostly conserved

625Amostly conserved

628Amostly conserved

AACTTTATACTTTATTTTTGGCATTTGAGCAGGAATAGTCGGTACTTCCTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCAGGACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.12%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anacampsis niveopulvellasame genus3.6%Anacampsis blattariellasame genus4.4%Anacampsis populellasame genus4.9%Anacampsis timidellasame genus5.9%Anacampsis agrimoniellasame genus7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type115 records

Wild obs. + sensor58

Museum / vouchered57

Range

Area of Occupancy AOO272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 39≤1 km 4>10 km 3

46 georeferenced · 12 without coordinates

Open the mapobservation + sensor58

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤1 km 14≤10 km 11>10 km 4

29 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence57

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	18
East Lansing, US	11
New Haven, US	9
Cornell University Insect Collectionlocation not on record	8
Philadelphia, US	6
Cambridge, US	1
Georgia Museum of Natural Historylocation not on record	1

7 institutions · 54 of 57 vouchered records shown · 3 without an institution code

09Environmental DNA23 detections

Where the DNA of Anacampsis innocuella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map1 country0

ForestTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 15.3–20.2

Seasonal swing summer↔winter31.1 °C

Max temp (day)24.7 °C 19.9–25.0

Min temp (night)16.0 °C 12.1–16.0

Precipitation95.1 mm/mo 80.1–103

Air humidity59.6 % 57.6–60.8

Moisture balance-39.6 mm/mo -46.3–-6.30

Vapour deficit926 Pa 684–957

Wind speed2.50 m/s 2.40–3.20

Cloud cover43.2 % 40.0–47.8

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)