Anacampsis timidella

(Wocke, 1887) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Anacampsis

At a glance

Occurrence records102

Data sources8

Biological traits0

DNA specimens30

eDNA detections41

Sources8 archives

Databases and archives Anacampsis timidella's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility102 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI41 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF102 records

Environmental DNA1 datasets · 6 countries41 detections

DNA & barcodingBOLD30 specimens

01Narrative

Anacampsis timidella is a moth of the family Gelechiidae. It is found in most of Europe, except Ireland, Great Britain, the Benelux, Denmark, Fennoscandia, the Baltic region, Slovenia and Bulgaria.Fauna Europaea The wingspan is 15–17 mm. The larvae feed on Quercus species, mainly Quercus pubescens from within a rolled leaf. The larvae are about 12 mm in length. They have a red-violet body and black-brown head.The Manual for Identification of Lepidoptera and Hymenoptera Defoliators: Damage and Larvae

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anacampsis timidella has left across the world's sequence archives.

At a glance

DNA specimens30

BINs2

Marker genes1

eDNA detections41

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

24Tmostly conserved

117Tmostly conserved

219Tvariable

291Cmostly conserved

334Amostly conserved

405Tmostly conserved

411Tmostly conserved

580Tmostly conserved

606Cmostly conserved

615Cmostly conserved

618Amostly conserved

652Cmostly conserved

ACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGTACATCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCTGGACAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.66%

Haplotypes3

BINs2

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anacampsis niveopulvellasame genus5.3%Anacampsis agrimoniellasame genus5.6%Anacampsis nonstrigellasame genus5.6%Anacampsis temerellasame genus5.6%Anacampsis scintillellasame genus5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type102 records

Wild obs. + sensor81

Museum / vouchered19

Other2

Range

Area of Occupancy AOO316 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 16≤1 km 24≤10 km 25

65 georeferenced · 16 without coordinates

Open the mapobservation + sensor81

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 3

6 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence19

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tartu, EE	2
National Institute of Biological Resourceslocation not on record	2
Provincia di Livornolocation not on record	2
University of Kaiserslauternlocation not on record	1
ZSMlocation not on record	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1
DanishLepidopterologicalSocietylocation not on record	1

7 institutions · 10 of 19 vouchered records shown · 9 without an institution code

09Environmental DNA41 detections

Where the DNA of Anacampsis timidella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found41

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 41 detections have coordinates

Open the map6 countries0

Floodplain forest1.1. Boreal Forest|1. Forest & Woodlandmixed forestflooded meadow, salix trees

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 13.9–20.5

Seasonal swing summer↔winter18.5 °C

Max temp (day)22.7 °C 18.2–24.6

Min temp (night)13.4 °C 9.10–16.0

Precipitation57.2 mm/mo 45.7–81.0

Air humidity58.1 % 55.7–59.5

Moisture balance-63.5 mm/mo -82.3–-12.7

Vapour deficit885 Pa 664–1,078

Wind speed2.80 m/s 2.00–3.30

Cloud cover35.8 % 33.9–39.6

CHELSA 1981–2010, ~9 km grid, at location & month of 41 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)