Anacampsis temerella

(Lienig & Zeller, 1846) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Anacampsis

At a glance

Occurrence records374

Data sources9

Biological traits2

DNA specimens8

eDNA detections24

Sources9 archives

Databases and archives Anacampsis temerella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility374 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF374 records

Environmental DNA3 datasets · 4 countries24 detections

DNA & barcodingBOLD8 specimens

Genome at a glanceNCBI≈431 Mbp

01Narrative

Anacampsis temerella is a moth of the family Gelechiidae. It is found in most of Europe, except Belgium, Switzerland, the Iberian Peninsula and the Balkan Peninsula. A sprig of Salix eaten by larva Larva The wingspan is 11–14 mm.microlepidoptera.nl The forewings are blackish, slightly violet-tinged ; stigmata deep black, very indistinct, first discal beyond plical ; a broad suffused black fascia at 2/3. Hindwings 1 rather dark grey.The larva is whitish ; dots black ; head and plate of 2 black.Meyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and description Adults are on wing in July and August.UKmoths The larvae feed on Salix species, including Salix phylicifolia, Salix caprea, Salix lapponum and Salix repens. They feed in a spinning in the terminal shoots of their host plant.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anacampsis temerella has left across the world's sequence archives.

At a glance

DNA specimens8

BINs2

Marker genes1

eDNA detections24

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Diversity (π)1.6%

Haplotypes2

BINs2

Most divergent pair5.6%

Where individuals differ — all 37 variable positions, in barcode order

10Cmostly conserved

13Cmostly conserved

46Cmostly conserved

70Tmostly conserved

85Amostly conserved

92Cmostly conserved

118Cmostly conserved

121Gmostly conserved

169Cmostly conserved

220Cmostly conserved

226Tmostly conserved

235Tmostly conserved

274Tmostly conserved

292Tmostly conserved

319Cmostly conserved

335Gmostly conserved

340Tmostly conserved

352Tmostly conserved

364Cmostly conserved

373Tmostly conserved

376Amostly conserved

400Tmostly conserved

403Cmostly conserved

415Tmostly conserved

418Tmostly conserved

445Cmostly conserved

451Amostly conserved

478Tmostly conserved

479Cmostly conserved

508Gmostly conserved

514Amostly conserved

526Tmostly conserved

529Cmostly conserved

547Tmostly conserved

556Amostly conserved

601Tmostly conserved

631Tmostly conserved

AACTTTATACTTCATTTTTGGTATTTGAGCAGGAATAGTTGGTACCTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCAGGACA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anacampsis timidellasame genus5.6%Anacampsis niveopulvellasame genus6.1%Anacampsis populellasame genus6.5%Anacampsis solemnellasame genus6.6%Anacampsis blattariellasame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceNCBI

The complete instruction manual Anacampsis temerella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈430 837 568 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anacampsis temerella0.43 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type374 records

Wild obs. + sensor228

Museum / vouchered146

Range

Area of Occupancy AOO792 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 80≤1 km 77≤10 km 64

221 georeferenced · 7 without coordinates

Open the mapobservation + sensor228

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 31≤1 km 52≤10 km 26

109 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence146

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	47
SLU Artdatabankenlocation not on record	16
Tartu, EE	15
Philadelphia, US	13
Stockholm, SE	12
NHMOlocation not on record	9
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	3
National Institute of Biological Resourceslocation not on record	2
Metsähallituslocation not on record	2
Rovaniemi, FI	2
South Kensington, GB	2
Kuopio, FI	1
neflocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1

14 institutions · 126 of 146 vouchered records shown · 20 without an institution code

09Environmental DNA24 detections

Where the DNA of Anacampsis temerella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys3

Countries4

Verifiable raw sequence linked17

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 13.4–16.1

Seasonal swing summer↔winter24.1 °C

Max temp (day)19.1 °C 15.9–19.5

Min temp (night)11.4 °C 10.0–13.6

Precipitation99.9 mm/mo 76.1–101

Air humidity59.3 % 59.0–61.4

Moisture balance-8.70 mm/mo

Vapour deficit734 Pa 589–751

Wind speed2.70 m/s

Cloud cover50.8 % 45.0–53.3

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)