Anacampsis niveopulvella

(Chambers, 1875) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Anacampsis

At a glance

Occurrence records462

Data sources8

Biological traits0

DNA specimens112

eDNA detections117

Sources8 archives

Databases and archives Anacampsis niveopulvella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility462 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI117 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics112 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF462 records

Environmental DNA1 datasets · 2 countries117 detections

DNA & barcodingBOLD112 specimens

01Narrative

Anacampsis niveopulvella, the pale-headed aspen leafroller moth, is a moth of the family Gelechiidae. It was described by Vactor Tousey Chambers in 1875. It is found in North America, where it has been recorded from Alberta, Arizona, British Columbia, California, Indiana, Maine, Manitoba and Ontario.Moth Photographers Group at Mississippi State University The wingspan is about 12 mm. The forewings are very dark brown, with a white spot on the disc before the middle and two or three small ones behind the middle, and an irregular white fascia posteriorly angulated at the beginning of the cilia. Under the lens, the wing appears to be pretty densely dusted with white and the spots are only aggregations of the dusting.The Canadian Entomologist 7 (11): 210 The larvae feed on Salix and Populus species.Bug Guide

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding112 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anacampsis niveopulvella has left across the world's sequence archives.

At a glance

DNA specimens112

BINs1

Marker genes1

eDNA detections117

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus88 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 57 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

3Cmostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

10Cmostly conserved

11Tmostly conserved

13Cmostly conserved

14Amostly conserved

15Tmostly conserved

16Tmostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

22Tmostly conserved

25Tmostly conserved

26Tmostly conserved

27Gmostly conserved

28Amostly conserved

30Cmostly conserved

31Amostly conserved

32Gmostly conserved

33Gmostly conserved

34Amostly conserved

35Amostly conserved

36Tmostly conserved

37Amostly conserved

38Gmostly conserved

40Cmostly conserved

41Gmostly conserved

44Amostly conserved

45Cmostly conserved

46Tmostly conserved

48Cmostly conserved

49Cmostly conserved

56Tmostly conserved

58Amostly conserved

59Tmostly conserved

60Tmostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

68Gmostly conserved

69Cmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

76Amostly conserved

77Gmostly conserved

78Gmostly conserved

80Amostly conserved

81Amostly conserved

82Tmostly conserved

169Tmostly conserved

AACTTTATACTTCATTTTTGGTATTTGAGCAGGAATAGTCGGTACTTCCTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCAGGACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.3%

Haplotypes5

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anacampsis blattariellasame genus2.7%Anacampsis populellasame genus3.2%Anacampsis innocuellasame genus3.6%Anacampsis timidellasame genus5.3%Anacampsis scintillellasame genus5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type462 records

Wild obs. + sensor225

Museum / vouchered237

Range

Area of Occupancy AOO664 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 178≤1 km 18≤10 km 3>10 km 8

207 georeferenced · 18 without coordinates

Open the mapobservation + sensor225

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 10≤1 km 3≤10 km 17>10 km 12

42 georeferenced · 195 without coordinates

Open the institutions mapphysical evidence237

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	54
University of Alberta Museums (UAM)location not on record	36
Cornell University Insect Collectionlocation not on record	16
New Haven, US	14
Philadelphia, US	13
Royal Saskatchewan Museumlocation not on record	12
Edmonton, CA	8
Washington, US	7
East Lansing, US	3
Colorado State Universitylocation not on record	2
Denver, US	1
St. Paul, US	1
University of Alaska Museumlocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Essig Museum of Entomologylocation not on record	1

15 institutions · 170 of 237 vouchered records shown · 67 without an institution code

09Environmental DNA117 detections

Where the DNA of Anacampsis niveopulvella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found117

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 117 detections have coordinates

Open the map2 countries0

Grassland4. Native Grassland1. Forest & Woodland|1.1 Boreal ForestForest1. Forest & Woodland|1.4. Temperate Forest1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 9.50–19.0

Seasonal swing summer↔winter24.3 °C

Max temp (day)22.1 °C 15.8–24.0

Min temp (night)10.8 °C 5.80–15.1

Precipitation71.6 mm/mo 39.7–97.9

Air humidity55.6 % 51.7–59.9

Moisture balance-50.5 mm/mo -85.7–10.9

Vapour deficit845 Pa 517–906

Wind speed2.70 m/s 1.40–3.70

Cloud cover39.6 % 31.4–54.2

CHELSA 1981–2010, ~9 km grid, at location & month of 116 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)